miRTarBase - #MIRT446864


—
pre-miRNA Information
pre-miRNA hsa-mir-4677   
Genomic Coordinates chr1: 243346176 - 243346255
Description Homo sapiens miR-4677 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4677-5p
Sequence 13| UUGUUCUUUGGUCUUUCAGCCA |34
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN10045564 8 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1050583047 19 dbSNP
rs1425855779 21 dbSNP
Putative Targets

Gene Information
Gene Symbol NBPF3   
Synonyms AE2
Description NBPF member 3
Transcript NM_032264   
Expression
Putative miRNA Targets on NBPF3
3'UTR of NBPF3
(miRNA target sites are highlighted)		 
>NBPF3|NM_032264|3'UTR
   1 GCAGCCCTTACTAAGCTGAGAGATGTCATTGCTGCAGGCAGGACGTATAGGCACATGTAGGTTTGAATGAAACTGTAGTT
  81 CCCTTTGGAAGCCCAGTCATAGGATGGGAAAGTGGGCATGGCTCTATTCCTATTCTCAGACCATGCCAGTGGCCACCTGT
 161 GCTCAGTCTGAAGACGTTGGACCCAAGTTAGGTGTGACACGTTCACACGACTATGTAGCACATGCCGGGAGTGATCTGCC
 241 AGACATTCTAATTTGAACCAGATATCTCTGGGTAGCTACAAAGTTCCTCAGGGGTTTCATTTTGCAGGCATGTCTCTGAG
 321 CTTCTATACCTGCTCAAGGTCAGTGTCATCTTTGTGTTTAGCTCATCCAAAGGTGTTACCCTGGTTTCATTGAACCTAAC
 401 CCCATTCTTTGTATCTTCAGTGTTGGTTTGTTTTAGCTGATCCATCTGTAACACAGGAGGGATCCTTGGCTGAGGATTGT
 481 ATTTCAGAACCACTGACTGCTCTTGACAGTTGTTAACCCACTAGGCTCCTTTGAGTAGAGAAGCCATAGTCCTTCAGCCT
 561 CCAATTGATATCAATACTTAGGAAGACCACAGCTAGACGGACAAACAGCATTGGGAGGCCTTAGTCCTGCTCCTTTCAAT
 641 TCCATCCTGTAAAGAACAGGAGTCAGGAGCCGCTGGCAAGAGACAGCATGTCACCTGGGACTCTGCCAGTGCAGAATATG
 721 AACAATGCCATGTTCTTGCAGAAAATGCTTAGCCTGAGTTTCATAGGAGGTAATCACCAGACAACTGCAGAATGTAGAAC
 801 ACTGAGCAGGACAACTGACCTGTCTCCTTCACACAGTCCACGTCACCACGAATCACACAACAAAAAGGAGGAGAGATATT
 881 TTGGGTTCAGAAGAAGTAAATGATAATGTAGCTACATTTCTTTAGTTATTTTGAACCCCAAATATTTCCTCATCTTTTTG
 961 TTGTTGTCATTGATTTTGGTGACATGGACTTGTTTGTAGAGGACAGGTCAGCTGTCTGGCTCAATGGTCTACATTCTGAA
1041 GTTGTCTGAAAATGTCTTCATGATTAAATTCAGCCTAAACGTTTCATCAAGAACACTACAGAGTCGATACTGTGAGTTTC
1121 CAACCTCAGCCCATCTGTGGGCAGAGAAGGTCTAGTTTGTCCATCAGCATTATCATGATATCAGGACTGGTTACTTGGTT
1201 AAGGAGGGGTCTAGGAGATCTGTCCCTTTTAGAGACACCTTACTTATGATGAAGTATTTGGGAGAGTGGTTTTTCAAAGT
1281 AGAAATGTCCTGTATTCCAGTGATCATCCTCTAAACGTTTTATCATTTATTAATCATCCCTGCCTGTGTCTATTATTATA
1361 TTCATATCTCTACGCTGGAAATTTGCTGCCTCAATGTTTACTGTGCCTTTGTTTTTGCTAGTGTGTGTTGTTGAAAAAAA
1441 AACATTCTCTGCCTGAGTTTTAATTTTTGTCCAAAGTTATTTTAATCTATACAATTAAAAACTTTTGCCTATCAAAAAAA
1521 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' accGACUUUC-UGGU--UUCUUGUu 5'
             || || |  :||  ||||||| 
Target 5' agcCTAAACGTTTCATCAAGAACAc 3'
 1072 - 1096 149.00 -5.90
2 
miRNA  3' accgacuuucugGUUUCUUGUu 5'
                      :|||||||| 
Target 5' aattccatcctgTAAAGAACAg 3'
 638 - 659 146.00 -9.40
3 
miRNA  3' accGACUUUCUGGUUUCUUGUu 5'
             |||  ||| :: |||||| 
Target 5' caaCTG-CAGAATGTAGAACAc 3'
 782 - 802 126.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30476148 143 COSMIC
COSN1431705 177 COSMIC
COSN17976881 324 COSMIC
COSN19239675 353 COSMIC
COSN15266878 697 COSMIC
COSN15248894 747 COSMIC
COSN26388037 850 COSMIC
COSN20571281 1107 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1318147009 2 dbSNP
rs1387532968 6 dbSNP
rs1383118655 8 dbSNP
rs1171764748 9 dbSNP
rs1423402207 12 dbSNP
rs761994804 13 dbSNP
rs1171537258 22 dbSNP
rs763064084 26 dbSNP
rs957241959 32 dbSNP
rs1320734422 34 dbSNP
rs1399673137 35 dbSNP
rs766331548 40 dbSNP
rs1966022 46 dbSNP
rs760063783 52 dbSNP
rs768196640 53 dbSNP
rs1328520332 57 dbSNP
rs1372349711 74 dbSNP
rs1436295076 93 dbSNP
rs1273413514 94 dbSNP
rs1365110658 99 dbSNP
rs1215990655 106 dbSNP
rs1258263100 117 dbSNP
rs1316758691 131 dbSNP
rs200969812 144 dbSNP
rs1275034480 161 dbSNP
rs1401642157 167 dbSNP
rs527600200 177 dbSNP
rs537845402 178 dbSNP
rs1436155422 185 dbSNP
rs1476242930 202 dbSNP
rs1194693776 209 dbSNP
rs1423099742 218 dbSNP
rs1464143083 228 dbSNP
rs1167190473 251 dbSNP
rs555884237 258 dbSNP
rs575120008 263 dbSNP
rs1405268540 264 dbSNP
rs1242963133 279 dbSNP
rs1354231550 282 dbSNP
rs75864255 295 dbSNP
rs1400925102 317 dbSNP
rs1278460245 322 dbSNP
rs200265424 324 dbSNP
rs535758060 325 dbSNP
rs1294556648 327 dbSNP
rs1373895382 329 dbSNP
rs1223002428 331 dbSNP
rs1287593200 349 dbSNP
rs991504472 357 dbSNP
rs1216994805 369 dbSNP
rs1262828120 371 dbSNP
rs1281832224 374 dbSNP
rs915867781 376 dbSNP
rs1190214260 380 dbSNP
rs1472488470 391 dbSNP
rs868667001 393 dbSNP
rs971408753 405 dbSNP
rs1420756797 411 dbSNP
rs981956459 412 dbSNP
rs1359542083 426 dbSNP
rs1397720526 431 dbSNP
rs4568798 438 dbSNP
rs1340583377 443 dbSNP
rs1243348963 445 dbSNP
rs1281179763 455 dbSNP
rs1352733502 461 dbSNP
rs908619099 464 dbSNP
rs1285018996 470 dbSNP
rs1487158788 478 dbSNP
rs1038466021 482 dbSNP
rs940225105 482 dbSNP
rs1441933371 487 dbSNP
rs920179562 491 dbSNP
rs1485383158 494 dbSNP
rs1440812178 496 dbSNP
rs1158467429 500 dbSNP
rs1209430134 501 dbSNP
rs1378873907 502 dbSNP
rs1436926170 508 dbSNP
rs1173973080 510 dbSNP
rs1474842927 513 dbSNP
rs1395002539 529 dbSNP
rs1331589215 536 dbSNP
rs1379090292 538 dbSNP
rs1235119500 542 dbSNP
rs932882751 547 dbSNP
rs113005877 564 dbSNP
rs1050110909 565 dbSNP
rs888809993 566 dbSNP
rs1406209168 575 dbSNP
rs1235073569 578 dbSNP
rs1455335938 596 dbSNP
rs1344577905 599 dbSNP
rs1198838816 600 dbSNP
rs554372445 607 dbSNP
rs1252726092 609 dbSNP
rs1173868683 611 dbSNP
rs1008547742 612 dbSNP
rs1236813892 615 dbSNP
rs1374377967 616 dbSNP
rs1432341297 617 dbSNP
rs1330235255 625 dbSNP
rs541405209 626 dbSNP
rs1170397823 630 dbSNP
rs1401886048 634 dbSNP
rs1465633237 640 dbSNP
rs1330611954 650 dbSNP
rs1040567444 668 dbSNP
rs1301679262 673 dbSNP
rs1330790096 681 dbSNP
rs1441327448 684 dbSNP
rs1260188686 687 dbSNP
rs3010179 697 dbSNP
rs1372872531 699 dbSNP
rs1236853808 707 dbSNP
rs78156905 708 dbSNP
rs3010180 709 dbSNP
rs759011996 710 dbSNP
rs1192187170 712 dbSNP
rs902927032 719 dbSNP
rs1217556301 720 dbSNP
rs1196313033 727 dbSNP
rs1275159375 727 dbSNP
rs1438925917 742 dbSNP
rs3010181 747 dbSNP
rs1169339687 748 dbSNP
rs1236802219 749 dbSNP
rs1459357102 756 dbSNP
rs1293989435 758 dbSNP
rs1470092615 779 dbSNP
rs1389781841 782 dbSNP
rs1384792409 783 dbSNP
rs1194589684 784 dbSNP
rs868326397 786 dbSNP
rs998697048 787 dbSNP
rs1169164763 791 dbSNP
rs1323530672 798 dbSNP
rs1032807699 815 dbSNP
rs957285981 826 dbSNP
rs1013277926 839 dbSNP
rs1487718271 842 dbSNP
rs1219235929 843 dbSNP
rs1022862923 848 dbSNP
rs1396487444 850 dbSNP
rs1488397098 851 dbSNP
rs1192357299 861 dbSNP
rs1420864153 862 dbSNP
rs753882021 866 dbSNP
rs1441387853 869 dbSNP
rs1165397442 870 dbSNP
rs543456643 872 dbSNP
rs1324901654 878 dbSNP
rs143325351 879 dbSNP
rs1299800320 880 dbSNP
rs530034361 883 dbSNP
rs908639597 886 dbSNP
rs1340146626 894 dbSNP
rs1228905540 905 dbSNP
rs1381437739 905 dbSNP
rs138886582 908 dbSNP
rs974229392 909 dbSNP
rs1256728806 914 dbSNP
rs1287167509 929 dbSNP
rs1337499409 938 dbSNP
rs920066850 942 dbSNP
rs187880241 952 dbSNP
rs986142683 953 dbSNP
rs1181923370 956 dbSNP
rs1255468946 957 dbSNP
rs1442663710 958 dbSNP
rs912814365 971 dbSNP
rs79659018 977 dbSNP
rs1418792315 981 dbSNP
rs1157097809 985 dbSNP
rs1361101548 987 dbSNP
rs371942294 993 dbSNP
rs1242264748 1005 dbSNP
rs1474787522 1011 dbSNP
rs1377696436 1025 dbSNP
rs1165595385 1032 dbSNP
rs1449673580 1047 dbSNP
rs1310574533 1049 dbSNP
rs1353439898 1069 dbSNP
rs944405116 1073 dbSNP
rs1281775785 1075 dbSNP
rs1313582891 1079 dbSNP
rs1040006420 1082 dbSNP
rs1210257004 1082 dbSNP
rs1419950357 1087 dbSNP
rs1180436984 1092 dbSNP
rs1238654797 1097 dbSNP
rs1461862526 1103 dbSNP
rs902939818 1105 dbSNP
rs1427580395 1106 dbSNP
rs1163978050 1107 dbSNP
rs1175571668 1133 dbSNP
rs1357527718 1144 dbSNP
rs113330999 1150 dbSNP
rs1332642279 1164 dbSNP
rs1376789454 1175 dbSNP
rs527493536 1177 dbSNP
rs1320516480 1194 dbSNP
rs1327183862 1208 dbSNP
rs552356262 1214 dbSNP
rs1369345633 1228 dbSNP
rs1219469911 1236 dbSNP
rs1277396061 1238 dbSNP
rs1430106201 1249 dbSNP
rs1199972958 1250 dbSNP
rs1276340407 1268 dbSNP
rs1357939646 1275 dbSNP
rs190849739 1276 dbSNP
rs1272989762 1281 dbSNP
rs1354683860 1283 dbSNP
rs1206590652 1295 dbSNP
rs2651410 1312 dbSNP
rs1065220 1318 dbSNP
rs570609392 1328 dbSNP
rs1258948174 1329 dbSNP
rs1475524236 1349 dbSNP
rs1478875160 1360 dbSNP
rs934368099 1367 dbSNP
rs16825364 1371 dbSNP
rs1366557563 1374 dbSNP
rs1455160615 1375 dbSNP
rs796758720 1383 dbSNP
rs201100878 1385 dbSNP
rs2651408 1386 dbSNP
rs1400290463 1395 dbSNP
rs1296475752 1412 dbSNP
rs1343251467 1434 dbSNP
rs1219983072 1443 dbSNP
rs1278255902 1443 dbSNP
rs1316698216 1455 dbSNP
rs1054191428 1457 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' accgacuuucugguUUCUUGUu 5'
                        ||||||| 
Target 5' ------------ucAAGAACAc 3'
 		1 - 10
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_032264 | 3UTR | CAAUUCCAUCCUGUAAAGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_032264 | 3UTR | UCCAUCCUGUAAAGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_032264 | 3UTR | CAAUUCCAUCCUGUAAAGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_032264 | 3UTR | CAUCCUGUAAAGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_032264 | 3UTR | AGACCACAGCUAGACGGACAAACAGCAUUGGGAGGCCUUAGUCCUGCUCCUUUCAAUUCCAUCCUGUAAAGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000318220.6 | 3UTR | UCAAGAACACUACAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000318220.6 | 3UTR | UCAAGAACACUACAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
84 hsa-miR-4677-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT080553 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT089446 STAMBP STAM binding protein 2 2
MIRT135057 ADSS adenylosuccinate synthase 2 4
MIRT263519 RPS24 ribosomal protein S24 2 2
MIRT357966 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT384298 GOLT1B golgi transport 1B 2 2
MIRT407003 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT442312 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT443782 ST13 ST13, Hsp70 interacting protein 2 2
MIRT446864 NBPF3 NBPF member 3 2 2
MIRT447642 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 2 2
MIRT448464 SLC45A4 solute carrier family 45 member 4 2 2
MIRT449117 XRRA1 X-ray radiation resistance associated 1 2 2
MIRT450240 TRIM66 tripartite motif containing 66 2 2
MIRT450265 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450682 RPN2 ribophorin II 2 2
MIRT465594 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT481118 AZIN1 antizyme inhibitor 1 2 4
MIRT497203 CDH7 cadherin 7 2 4
MIRT502954 CCNT2 cyclin T2 2 2
MIRT506337 NUP54 nucleoporin 54 2 4
MIRT509224 KIF14 kinesin family member 14 2 6
MIRT514595 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT515392 ARHGAP21 Rho GTPase activating protein 21 2 4
MIRT525555 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525604 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT533249 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT535778 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535799 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT552784 YAF2 YY1 associated factor 2 2 2
MIRT556213 MB21D2 Mab-21 domain containing 2 2 2
MIRT558192 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT565809 SDCCAG3 serologically defined colon cancer antigen 3 2 2
MIRT566341 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567792 DEK DEK proto-oncogene 2 2
MIRT572455 ZNF516 zinc finger protein 516 2 2
MIRT572582 HGFAC HGF activator 2 2
MIRT573357 PDE3A phosphodiesterase 3A 2 2
MIRT574649 LMAN2 lectin, mannose binding 2 2 2
MIRT608164 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT610690 FAM89A family with sequence similarity 89 member A 2 2
MIRT618457 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT621924 SYAP1 synapse associated protein 1 2 4
MIRT622279 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624610 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT631040 TAS2R30 taste 2 receptor member 30 2 2
MIRT636153 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT638255 SIX1 SIX homeobox 1 2 2
MIRT638330 RCAN1 regulator of calcineurin 1 2 2
MIRT641621 KIAA1244 ARFGEF family member 3 3 3
MIRT644556 SPOP speckle type BTB/POZ protein 2 2
MIRT645900 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT649115 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT652244 TPI1 triosephosphate isomerase 1 2 2
MIRT657249 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT659857 CAPRIN1 cell cycle associated protein 1 2 4
MIRT665369 XIAP X-linked inhibitor of apoptosis 2 2
MIRT669214 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT682579 CPA4 carboxypeptidase A4 2 2
MIRT698725 STX6 syntaxin 6 2 4
MIRT699788 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT700290 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT710374 LMBR1 limb development membrane protein 1 2 2
MIRT710407 YTHDC1 YTH domain containing 1 2 2
MIRT710569 TNPO1 transportin 1 2 2
MIRT711384 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT712042 STYK1 serine/threonine/tyrosine kinase 1 2 2
MIRT712717 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713288 ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif 20 2 2
MIRT715649 USP6NL USP6 N-terminal like 2 2
MIRT716167 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716756 TRABD2A TraB domain containing 2A 2 2
MIRT718209 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT718361 SOX1 SRY-box 1 2 2
MIRT718806 SLC25A33 solute carrier family 25 member 33 2 2
MIRT719339 VGLL4 vestigial like family member 4 2 2
MIRT719671 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT720827 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT722184 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT722398 BCAS2 BCAS2, pre-mRNA processing factor 2 2
MIRT723460 ST8SIA3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 2 2
MIRT724072 NCKAP1L NCK associated protein 1 like 2 2
MIRT724594 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT725234 PDE1B phosphodiesterase 1B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4677 Doxorubicin 31703 NSC123127 approved resistant High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-mir-4677 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-4677 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-4677-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4677-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4677-5p Platinum 23939 sensitive tissue (non-small cell lung cancer)
hsa-miR-4677-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-4677-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)

Error report submission