miRTarBase - #MIRT447093


—
pre-miRNA Information
pre-miRNA hsa-mir-4524b   
Genomic Coordinates chr17: 69099542 - 69099656
Description Homo sapiens miR-4524b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524b-3p
Sequence 66| GAGACAGGUUCAUGCUGCUA |85
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1263495678 1 dbSNP
rs1350790266 9 dbSNP
rs1322445998 14 dbSNP
Putative Targets

Gene Information
Gene Symbol COPRS   
Synonyms C17orf79, COPR5, HSA272196, TTP1
Description coordinator of PRMT5 and differentiation stimulator
Transcript NM_018405   
Expression
Putative miRNA Targets on COPRS
3'UTR of COPRS
(miRNA target sites are highlighted)		 
>COPRS|NM_018405|3'UTR
   1 GTGTGGAGCTTTCTGCCTTGTAGGTGGGCGGGCCTCCACGTCAAGATCTCTTTTCCTGTCTTGGAGGTGAAAAGTCATAT
  81 CTGAGAAAATGTTTGCAGTGACCCCTAGTCTGGGGTACACAGACCAGTGTTCCTTATTGACAGTGTTCAATAAGGCCCCG
 161 TCATTCTCGCCAGTCTGTTGTTGTTCTTAATGGGCTCCTCCTTGAAATGTGTGTGTGTTTGTGTCAAGAGGAGTTGTGTT
 241 CTTTGTAAATAAAGGTTAAAAAGAGAAACCAGTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aucgucguacuuGGACAGAg 5'
                      ||||||| 
Target 5' aagatctcttttCCTGTCTt 3'
 43 - 62 140.00 -11.17
2 
miRNA  3' auCGUCGUACU-UGGA-CAGAg 5'
            ||||  |||  ||| |||| 
Target 5' ttGCAG--TGACCCCTAGTCTg 3'
 93 - 112 122.00 -10.20
3 
miRNA  3' aucGUCGUA--CUUGGACAGAg 5'
             |: |||    :|| |||| 
Target 5' cccCGTCATTCTCGCCAGTCTg 3'
 156 - 177 111.00 -5.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30169960 25 COSMIC
COSN30140687 29 COSMIC
COSN30538208 33 COSMIC
COSN6101835 39 COSMIC
COSN30102594 45 COSMIC
COSN30103488 49 COSMIC
COSN30468284 67 COSMIC
COSN30542201 104 COSMIC
COSN31479458 120 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1374406778 3 dbSNP
rs776859907 4 dbSNP
rs1223452172 8 dbSNP
rs1490294794 9 dbSNP
rs372086660 12 dbSNP
rs1216687667 13 dbSNP
rs534335505 17 dbSNP
rs988351510 20 dbSNP
rs181069895 21 dbSNP
rs1215841256 24 dbSNP
rs757879475 29 dbSNP
rs747608626 30 dbSNP
rs778871427 31 dbSNP
rs1207478505 32 dbSNP
rs368404872 39 dbSNP
rs753690350 40 dbSNP
rs548598623 42 dbSNP
rs1301132328 43 dbSNP
rs531630213 46 dbSNP
rs751759234 48 dbSNP
rs1180837629 52 dbSNP
rs1378875197 80 dbSNP
rs1439579042 85 dbSNP
rs879141455 89 dbSNP
rs1231088481 104 dbSNP
rs34880513 109 dbSNP
rs1044087 110 dbSNP
rs1438150728 117 dbSNP
rs944290439 117 dbSNP
rs761377461 122 dbSNP
rs141300765 125 dbSNP
rs552063874 137 dbSNP
rs1345833574 145 dbSNP
rs1302675268 150 dbSNP
rs190297695 157 dbSNP
rs953136851 159 dbSNP
rs559964054 160 dbSNP
rs1275353436 169 dbSNP
rs1278272308 186 dbSNP
rs1216904497 193 dbSNP
rs1277311850 206 dbSNP
rs1236022563 219 dbSNP
rs1318111403 219 dbSNP
rs916445533 219 dbSNP
rs1053712733 221 dbSNP
rs778992365 221 dbSNP
rs1248960347 223 dbSNP
rs936297552 223 dbSNP
rs1336690378 226 dbSNP
rs1309502162 228 dbSNP
rs923623637 243 dbSNP
rs1420348829 248 dbSNP
rs534565752 267 dbSNP
rs1168759464 269 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000302362.6 | 3UTR | UCAAGAUCUCUUUUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000302362.6 | 3UTR | UCAAGAUCUCUUUUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
175 hsa-miR-4524b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064889 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT075345 SF3B3 splicing factor 3b subunit 3 2 2
MIRT094174 PCGF3 polycomb group ring finger 3 2 6
MIRT100109 ABT1 activator of basal transcription 1 2 8
MIRT102242 HBP1 HMG-box transcription factor 1 2 2
MIRT124918 HCCS holocytochrome c synthase 2 2
MIRT140195 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT193891 HACD3 3-hydroxyacyl-CoA dehydratase 3 2 2
MIRT265634 LDHA lactate dehydrogenase A 2 2
MIRT303878 VAMP8 vesicle associated membrane protein 8 2 2
MIRT409756 CRTAP cartilage associated protein 2 4
MIRT441503 SPG20 spartin 2 6
MIRT446882 ZNF554 zinc finger protein 554 2 2
MIRT447093 COPRS coordinator of PRMT5 and differentiation stimulator 2 2
MIRT449987 AEN apoptosis enhancing nuclease 2 2
MIRT452116 IFITM1 interferon induced transmembrane protein 1 2 2
MIRT452654 ZNF33A zinc finger protein 33A 2 2
MIRT453886 IFRD1 interferon related developmental regulator 1 2 12
MIRT454143 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT454501 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT456633 ARMCX6 armadillo repeat containing, X-linked 6 2 2
MIRT457021 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT457055 NEGR1 neuronal growth regulator 1 2 2
MIRT457335 REG4 regenerating family member 4 2 2
MIRT457421 CASC5 kinetochore scaffold 1 2 2
MIRT457940 LCE1A late cornified envelope 1A 2 2
MIRT458486 RMI1 RecQ mediated genome instability 1 2 10
MIRT458662 PAGR1 PAXIP1 associated glutamate rich protein 1 2 12
MIRT459784 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT459864 SVOP SV2 related protein 2 2
MIRT460575 FEM1A fem-1 homolog A 2 2
MIRT460987 STK17B serine/threonine kinase 17b 2 2
MIRT462315 TMEM109 transmembrane protein 109 2 2
MIRT464407 URM1 ubiquitin related modifier 1 2 2
MIRT465148 TSC22D2 TSC22 domain family member 2 2 2
MIRT466312 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT466718 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT468258 SFXN4 sideroflexin 4 2 2
MIRT469140 RNF126 ring finger protein 126 2 2
MIRT471783 NUP153 nucleoporin 153 2 2
MIRT472506 NACC2 NACC family member 2 2 2
MIRT474588 KLF6 Kruppel like factor 6 2 2
MIRT475049 JOSD1 Josephin domain containing 1 2 2
MIRT476900 FBXO21 F-box protein 21 2 2
MIRT476972 FAM83G family with sequence similarity 83 member G 2 4
MIRT477433 EMP1 epithelial membrane protein 1 2 2
MIRT480334 C5orf51 chromosome 5 open reading frame 51 2 10
MIRT481179 AVL9 AVL9 cell migration associated 2 6
MIRT481693 AR androgen receptor 2 2
MIRT483280 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 4
MIRT485775 B4GALT5 beta-1,4-galactosyltransferase 5 2 2
MIRT487424 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT488002 RXRB retinoid X receptor beta 2 2
MIRT488259 DNLZ DNL-type zinc finger 2 4
MIRT490360 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT491593 USB1 U6 snRNA biogenesis phosphodiesterase 1 2 2
MIRT495269 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 4
MIRT495619 ZNF736 zinc finger protein 736 2 2
MIRT496167 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT496250 GJB2 gap junction protein beta 2 2 2
MIRT496915 RTKN rhotekin 2 2
MIRT498713 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT501106 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501831 NCOA3 nuclear receptor coactivator 3 2 2
MIRT507142 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT510991 PER1 period circadian clock 1 2 4
MIRT512283 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT513152 CSDC2 cold shock domain containing C2 2 2
MIRT513327 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 6
MIRT515090 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT516113 OARD1 O-acyl-ADP-ribose deacylase 1 2 8
MIRT516657 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT516892 PLEKHS1 pleckstrin homology domain containing S1 2 2
MIRT517966 ZMIZ2 zinc finger MIZ-type containing 2 2 4
MIRT519492 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT519799 ZNF226 zinc finger protein 226 2 2
MIRT524309 CTC1 CST telomere replication complex component 1 2 8
MIRT524425 CNKSR3 CNKSR family member 3 2 2
MIRT525927 KIAA0391 KIAA0391 2 2
MIRT528022 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528227 METTL8 methyltransferase like 8 2 2
MIRT528686 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT528774 CD1D CD1d molecule 2 2
MIRT529935 P2RX7 purinergic receptor P2X 7 2 2
MIRT530642 PPIC peptidylprolyl isomerase C 2 4
MIRT530683 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531922 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532181 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534996 PRR11 proline rich 11 2 6
MIRT535452 PDCL phosducin like 2 4
MIRT544682 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT553757 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT560724 ZNF749 zinc finger protein 749 2 2
MIRT561518 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT561578 SLC30A1 solute carrier family 30 member 1 2 2
MIRT562483 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT565039 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565348 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT567104 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT568879 LY6H lymphocyte antigen 6 family member H 2 2
MIRT569141 NAP1L4 nucleosome assembly protein 1 like 4 2 2
MIRT569199 LRRC3C leucine rich repeat containing 3C 2 2
MIRT573559 TMEM120B transmembrane protein 120B 2 2
MIRT575931 Mrrf mitochondrial ribosome recycling factor 2 6
MIRT607035 MRRF mitochondrial ribosome recycling factor 2 9
MIRT607194 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT609682 TMEM213 transmembrane protein 213 2 2
MIRT611227 ZNF274 zinc finger protein 274 2 2
MIRT611370 PLXDC1 plexin domain containing 1 2 4
MIRT611640 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT613011 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT613532 GTSE1 G2 and S-phase expressed 1 2 2
MIRT614459 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT616492 CD300E CD300e molecule 2 2
MIRT617288 GTF2H3 general transcription factor IIH subunit 3 2 2
MIRT618356 CDKL1 cyclin dependent kinase like 1 2 2
MIRT619529 ZNF74 zinc finger protein 74 2 2
MIRT619990 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT621286 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT621482 GPKOW G-patch domain and KOW motifs 2 2
MIRT625456 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT626757 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 2 2
MIRT629138 CTCFL CCCTC-binding factor like 2 2
MIRT630092 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT633501 RNF14 ring finger protein 14 2 2
MIRT633604 APCDD1 APC down-regulated 1 2 2
MIRT633772 F2 coagulation factor II, thrombin 2 2
MIRT635605 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637422 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT637822 PLA2G7 phospholipase A2 group VII 2 2
MIRT637978 RRP36 ribosomal RNA processing 36 2 2
MIRT638385 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638547 KIAA1549 KIAA1549 2 2
MIRT642019 NCKIPSD NCK interacting protein with SH3 domain 2 2
MIRT643342 MICA MHC class I polypeptide-related sequence A 2 2
MIRT644281 LRRC57 leucine rich repeat containing 57 2 2
MIRT646818 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT646839 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT646976 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 2
MIRT647735 CXCR2 C-X-C motif chemokine receptor 2 2 2
MIRT648598 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT649843 LIPG lipase G, endothelial type 2 2
MIRT650031 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT652082 TSPAN14 tetraspanin 14 2 2
MIRT652103 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT652902 SYNPO2L synaptopodin 2 like 2 2
MIRT653549 SLC38A7 solute carrier family 38 member 7 2 2
MIRT653981 SEMA6B semaphorin 6B 2 2
MIRT654287 RCAN1 regulator of calcineurin 1 2 2
MIRT658372 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT660321 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT663063 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT663269 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 2 2
MIRT664076 ZNF417 zinc finger protein 417 2 2
MIRT664193 MYOZ2 myozenin 2 2 2
MIRT664512 POLR3K RNA polymerase III subunit K 2 2
MIRT667025 PDF peptide deformylase, mitochondrial 2 2
MIRT669621 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT670530 MLLT6 MLLT6, PHD finger containing 2 2
MIRT673050 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT683339 ZNF581 zinc finger protein 581 2 2
MIRT689264 WDR83OS WD repeat domain 83 opposite strand 2 2
MIRT690902 TOP2A DNA topoisomerase II alpha 2 2
MIRT699196 SLX4IP SLX4 interacting protein 2 2
MIRT702223 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT707053 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT707080 MED29 mediator complex subunit 29 2 2
MIRT712347 NLN neurolysin 2 2
MIRT714715 KIT KIT proto-oncogene receptor tyrosine kinase 2 2
MIRT715963 CES4A carboxylesterase 4A 2 2
MIRT718224 DEFB105B defensin beta 105B 2 2
MIRT718244 DEFB105A defensin beta 105A 2 2
MIRT721960 GCK glucokinase 2 2
MIRT723098 SERINC3 serine incorporator 3 2 2
MIRT725207 PTPRT protein tyrosine phosphatase, receptor type T 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4524b Tripterygium wilfordii Hook F resistant tissue
hsa-miR-4524b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)

Error report submission