miRTarBase - #MIRT447136


—
pre-miRNA Information
pre-miRNA hsa-let-7e   
Genomic Coordinates chr19: 51692786 - 51692864
Synonyms MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E
Description Homo sapiens let-7e stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7e-5p
Sequence 8| UGAGGUAGGAGGUUGUAUAGUU |29
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1189776118 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIF27   
Synonyms -
Description kinesin family member 27
Transcript NM_017576   
Expression
Putative miRNA Targets on KIF27
3'UTR of KIF27
(miRNA target sites are highlighted)		 
>KIF27|NM_017576|3'UTR
   1 ACATTGAATAATAGAACTTTTAGTAGATATGTAAAAAGATTCCTTTTTCTAACCTGTTAAAAACTAAAGCTCAAGTTCAC
  81 TACCTCTTTCCTCAGAATAAAGGAAGAAGGGGAGGAAGGAATCCCTAATTCTTTTATATGCTATAGATGTGTACATCTTC
 161 TATATATATTTGGGGAGTTTTAGTTTATATTCCCATAGTAATCAAACATGTTTTCCAATACTTGATAACATTTAAATATT
 241 TATAAATACGCTTAAATGTTTTTCCAGGCATATTTGAAGATTAAAACTAGTAATAGACTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGAUAU---GUUGGAG-GAUGGAGu 5'
            ||| |   ||| :|| ||||||| 
Target 5' aaCTAAAGCTCAAGTTCACTACCTCt 3'
 62 - 87 160.00 -17.30
2 
miRNA  3' uugauaugUUGGAGGAUGGAGU 5'
                  ||:| |||| :|| 
Target 5' gaggaaggAATC-CCTAATTCT 3'
 112 - 132 105.00 -8.10
3 
miRNA  3' uugaUAUGUUGGAGGA-UGGAgu 5'
              || |  ::|:|| ||||  
Target 5' aaagATTCCTTTTTCTAACCTgt 3'
 35 - 57 102.00 -6.89
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31583580 10 COSMIC
COSN30100887 27 COSMIC
COSN14400808 38 COSMIC
COSN30544022 70 COSMIC
COSN31507645 82 COSMIC
COSN30113773 131 COSMIC
COSN2330884 138 COSMIC
COSN508909 148 COSMIC
COSN30526679 164 COSMIC
COSN30127948 173 COSMIC
COSN9525529 224 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1226162482 4 dbSNP
rs757454786 6 dbSNP
rs754124489 8 dbSNP
rs1219836928 9 dbSNP
rs764316964 12 dbSNP
rs372447063 24 dbSNP
rs1388578130 30 dbSNP
rs1391466176 34 dbSNP
rs752809311 37 dbSNP
rs768041763 41 dbSNP
rs566683803 42 dbSNP
rs1172522669 45 dbSNP
rs1287571597 53 dbSNP
rs1384853192 56 dbSNP
rs1387927009 65 dbSNP
rs554834323 84 dbSNP
rs1469862781 95 dbSNP
rs957914493 96 dbSNP
rs1180971722 111 dbSNP
rs1460318753 112 dbSNP
rs1318744147 118 dbSNP
rs1236993356 122 dbSNP
rs1263075034 123 dbSNP
rs1203690869 145 dbSNP
rs1313468343 148 dbSNP
rs188795204 151 dbSNP
rs773791249 164 dbSNP
rs2542778 171 dbSNP
rs1192576229 173 dbSNP
rs1373699107 177 dbSNP
rs1311100525 183 dbSNP
rs1380542130 189 dbSNP
rs569233318 197 dbSNP
rs1450203185 209 dbSNP
rs1381891146 225 dbSNP
rs980416240 231 dbSNP
rs1420563571 232 dbSNP
rs1156306850 233 dbSNP
rs1337347812 236 dbSNP
rs1467560691 247 dbSNP
rs114906794 249 dbSNP
rs1157085667 250 dbSNP
rs574062286 267 dbSNP
rs1440632320 268 dbSNP
rs183697978 274 dbSNP
rs571734761 281 dbSNP
rs1222352748 294 dbSNP
rs1013303913 296 dbSNP
rs1322456323 298 dbSNP
rs760271908 307 dbSNP
rs1381154555 309 dbSNP
rs1233773255 311 dbSNP
rs1275010321 327 dbSNP
rs1160763360 328 dbSNP
rs1443187461 333 dbSNP
rs1212822528 334 dbSNP
rs1238631944 337 dbSNP
rs547236518 338 dbSNP
rs193276058 346 dbSNP
rs1249149205 352 dbSNP
rs1423919273 358 dbSNP
rs1167642298 370 dbSNP
rs898006006 371 dbSNP
rs368981054 381 dbSNP
rs1006457665 384 dbSNP
rs1050423665 392 dbSNP
rs1317083171 393 dbSNP
rs1297844285 394 dbSNP
rs931965466 395 dbSNP
rs1287748517 396 dbSNP
rs1243448837 397 dbSNP
rs901808174 399 dbSNP
rs1315531018 400 dbSNP
rs1353480561 400 dbSNP
rs115992817 401 dbSNP
rs1201952669 401 dbSNP
rs1250415290 402 dbSNP
rs1189433727 403 dbSNP
rs1485678223 403 dbSNP
rs1359863603 409 dbSNP
rs1195100588 410 dbSNP
rs187445401 410 dbSNP
rs946130760 410 dbSNP
rs1287121719 414 dbSNP
rs1408605218 414 dbSNP
rs987962066 436 dbSNP
rs1359981002 445 dbSNP
rs936598236 450 dbSNP
rs1361354824 454 dbSNP
rs1354953525 456 dbSNP
rs182332265 460 dbSNP
rs925188341 464 dbSNP
rs1160711636 465 dbSNP
rs969469412 471 dbSNP
rs1212632868 475 dbSNP
rs1384975581 477 dbSNP
rs1165996723 483 dbSNP
rs1426009374 486 dbSNP
rs1217080485 492 dbSNP
rs1418014394 493 dbSNP
rs1185384059 507 dbSNP
rs1244340607 508 dbSNP
rs1474599297 509 dbSNP
rs1488351259 514 dbSNP
rs1264754465 519 dbSNP
rs1024618697 523 dbSNP
rs1396107244 529 dbSNP
rs562145944 529 dbSNP
rs1219773631 535 dbSNP
rs1490101113 540 dbSNP
rs1420383808 557 dbSNP
rs1318817982 561 dbSNP
rs190010979 569 dbSNP
rs1346877700 571 dbSNP
rs992330092 581 dbSNP
rs961807783 585 dbSNP
rs1371527207 586 dbSNP
rs1015069754 591 dbSNP
rs1300847958 596 dbSNP
rs1006340145 597 dbSNP
rs888061589 601 dbSNP
rs372098984 606 dbSNP
rs1285815354 607 dbSNP
rs1445743517 609 dbSNP
rs185699822 614 dbSNP
rs1029206810 615 dbSNP
rs996401876 624 dbSNP
rs1402118968 627 dbSNP
rs1292226328 632 dbSNP
rs1470667038 636 dbSNP
rs1246725212 643 dbSNP
rs901861002 650 dbSNP
rs1294799213 656 dbSNP
rs1040347725 659 dbSNP
rs576554886 664 dbSNP
rs891869619 666 dbSNP
rs1052306354 667 dbSNP
rs1442839615 671 dbSNP
rs1214017724 673 dbSNP
rs369845174 675 dbSNP
rs1442535464 677 dbSNP
rs1280763136 682 dbSNP
rs10590173 687 dbSNP
rs199995145 687 dbSNP
rs936482297 691 dbSNP
rs1223677710 693 dbSNP
rs1274354445 704 dbSNP
rs925075284 709 dbSNP
rs1403316262 711 dbSNP
rs1212192963 720 dbSNP
rs1365197826 721 dbSNP
rs540091729 728 dbSNP
rs981099557 729 dbSNP
rs1231203174 737 dbSNP
rs1469720020 738 dbSNP
rs749896268 747 dbSNP
rs1170323879 753 dbSNP
rs1463004868 759 dbSNP
rs1478464191 771 dbSNP
rs182788678 783 dbSNP
rs1389804058 786 dbSNP
rs991819899 786 dbSNP
rs1479867560 789 dbSNP
rs1440857716 795 dbSNP
rs1293435642 797 dbSNP
rs961808538 798 dbSNP
rs375102982 812 dbSNP
rs1272922630 829 dbSNP
rs2542777 835 dbSNP
rs907620205 836 dbSNP
rs1197733665 847 dbSNP
rs1271158180 848 dbSNP
rs1437261083 853 dbSNP
rs1188735301 860 dbSNP
rs984468515 868 dbSNP
rs952215675 871 dbSNP
rs1199168494 873 dbSNP
rs1185736759 880 dbSNP
rs1029092272 881 dbSNP
rs1280163135 883 dbSNP
rs767256346 889 dbSNP
rs1393858750 890 dbSNP
rs996847413 895 dbSNP
rs554614946 908 dbSNP
rs966309051 911 dbSNP
rs191524773 912 dbSNP
rs1302286403 917 dbSNP
rs1388788655 921 dbSNP
rs1327323951 932 dbSNP
rs1394757410 938 dbSNP
rs1298025323 950 dbSNP
rs1268851873 955 dbSNP
rs1338979760 977 dbSNP
rs1211918627 979 dbSNP
rs1282499901 980 dbSNP
rs569133571 992 dbSNP
rs1208552836 994 dbSNP
rs1255396547 999 dbSNP
rs1429108415 1017 dbSNP
rs891920232 1021 dbSNP
rs1173557120 1029 dbSNP
rs1371166483 1037 dbSNP
rs1054553676 1045 dbSNP
rs1468851801 1046 dbSNP
rs1377800767 1064 dbSNP
rs1200508776 1080 dbSNP
rs1432332872 1101 dbSNP
rs1302723435 1102 dbSNP
rs2780136 1122 dbSNP
rs2780135 1126 dbSNP
rs1364948382 1133 dbSNP
rs1000242368 1137 dbSNP
rs1305900935 1159 dbSNP
rs1345739541 1168 dbSNP
rs903701311 1182 dbSNP
rs2780134 1195 dbSNP
rs557405938 1196 dbSNP
rs947988607 1201 dbSNP
rs917838290 1202 dbSNP
rs1464299092 1203 dbSNP
rs1056565122 1204 dbSNP
rs539005005 1205 dbSNP
rs940367471 1212 dbSNP
rs571796413 1215 dbSNP
rs1174744512 1222 dbSNP
rs907507396 1225 dbSNP
rs768275700 1226 dbSNP
rs984522417 1227 dbSNP
rs1201812959 1228 dbSNP
rs1442113358 1231 dbSNP
rs1328407491 1232 dbSNP
rs144471206 1233 dbSNP
rs1307767308 1239 dbSNP
rs1256716625 1243 dbSNP
rs1318834820 1244 dbSNP
rs1235681372 1253 dbSNP
rs1266171572 1258 dbSNP
rs2780133 1259 dbSNP
rs922124958 1264 dbSNP
rs974922961 1266 dbSNP
rs1254735173 1276 dbSNP
rs966737248 1280 dbSNP
rs1190323640 1299 dbSNP
rs1306655019 1307 dbSNP
rs1420354554 1309 dbSNP
rs1448000032 1310 dbSNP
rs1019186169 1313 dbSNP
rs1010871081 1315 dbSNP
rs1411851728 1317 dbSNP
rs1462490252 1327 dbSNP
rs1167510393 1338 dbSNP
rs956028539 1350 dbSNP
rs1457549806 1352 dbSNP
rs1298995316 1354 dbSNP
rs1375541278 1355 dbSNP
rs1389758660 1360 dbSNP
rs1335353623 1362 dbSNP
rs36048326 1365 dbSNP
rs1349797131 1366 dbSNP
rs2780132 1379 dbSNP
rs1233871613 1381 dbSNP
rs1032990372 1383 dbSNP
rs1319730194 1389 dbSNP
rs534944703 1393 dbSNP
rs1220282589 1394 dbSNP
rs1402264196 1396 dbSNP
rs141542000 1405 dbSNP
rs1451166213 1412 dbSNP
rs1193562877 1416 dbSNP
rs1250479067 1421 dbSNP
rs1362863976 1421 dbSNP
rs549261724 1424 dbSNP
rs1416090425 1432 dbSNP
rs1441351845 1453 dbSNP
rs879150544 1456 dbSNP
rs1171327774 1458 dbSNP
rs1000309240 1461 dbSNP
rs1460722572 1470 dbSNP
rs187037412 1470 dbSNP
rs563613477 1471 dbSNP
rs1415275129 1493 dbSNP
rs1012073089 1495 dbSNP
rs1227515851 1496 dbSNP
rs1256951287 1499 dbSNP
rs896272077 1500 dbSNP
rs1202252276 1538 dbSNP
rs2780131 1539 dbSNP
rs1273218951 1542 dbSNP
rs1056384956 1554 dbSNP
rs940586715 1561 dbSNP
rs1483242293 1567 dbSNP
rs907558399 1573 dbSNP
rs1422148690 1581 dbSNP
rs1241277713 1585 dbSNP
rs1287103051 1587 dbSNP
rs1048700200 1595 dbSNP
rs550158304 1597 dbSNP
rs975353216 1602 dbSNP
rs1357351132 1603 dbSNP
rs944900550 1611 dbSNP
rs1289205941 1612 dbSNP
rs550192418 1620 dbSNP
rs1225677466 1628 dbSNP
rs1296421444 1633 dbSNP
rs1347900414 1639 dbSNP
rs989081650 1641 dbSNP
rs1275975749 1656 dbSNP
rs1312095799 1657 dbSNP
rs761312883 1664 dbSNP
rs748983953 1667 dbSNP
rs1463849670 1669 dbSNP
rs1188098684 1673 dbSNP
rs1253850602 1680 dbSNP
rs956261990 1681 dbSNP
rs1341656085 1693 dbSNP
rs1170858386 1699 dbSNP
rs1424608632 1715 dbSNP
rs1033033194 1732 dbSNP
rs1346673936 1738 dbSNP
rs1380053140 1738 dbSNP
rs774138772 1740 dbSNP
rs978755088 1742 dbSNP
rs1319710565 1787 dbSNP
rs1371273388 1790 dbSNP
rs768402397 1791 dbSNP
rs970581213 1802 dbSNP
rs1421195299 1803 dbSNP
rs1023054348 1808 dbSNP
rs1224791113 1814 dbSNP
rs1014714124 1816 dbSNP
rs113359196 1819 dbSNP
rs1274237379 1822 dbSNP
rs145877019 1828 dbSNP
rs896336939 1828 dbSNP
rs1004787132 1829 dbSNP
rs1197054049 1829 dbSNP
rs768796984 1829 dbSNP
rs886342145 1833 dbSNP
rs1162769870 1836 dbSNP
rs1158106210 1840 dbSNP
rs1473047312 1841 dbSNP
rs1048756714 1845 dbSNP
rs930306309 1851 dbSNP
rs1321214089 1853 dbSNP
rs1370135136 1857 dbSNP
rs900133729 1860 dbSNP
rs1280849053 1864 dbSNP
rs1349134683 1865 dbSNP
rs1038785964 1869 dbSNP
rs892736182 1872 dbSNP
rs1294237613 1875 dbSNP
rs1337444910 1877 dbSNP
rs1445381848 1881 dbSNP
rs944431307 1902 dbSNP
rs1262616259 1909 dbSNP
rs912077799 1912 dbSNP
rs1489425499 1916 dbSNP
rs1249767542 1924 dbSNP
rs1471557787 1925 dbSNP
rs988958885 1927 dbSNP
rs1290035317 1929 dbSNP
rs34810190 1929 dbSNP
rs1418258751 1951 dbSNP
rs372040704 1953 dbSNP
rs1161040150 1959 dbSNP
rs1228109015 1959 dbSNP
rs1389556851 1967 dbSNP
rs934939186 1977 dbSNP
rs1309289131 1979 dbSNP
rs926185268 1980 dbSNP
rs978974660 1981 dbSNP
rs564678681 1990 dbSNP
rs1357692716 1992 dbSNP
rs1225931300 1996 dbSNP
rs540320229 1999 dbSNP
rs1243053384 2000 dbSNP
rs1023361505 2001 dbSNP
rs992938303 2020 dbSNP
rs960385640 2028 dbSNP
rs149588855 2035 dbSNP
rs1401459859 2038 dbSNP
rs1004672486 2045 dbSNP
rs1204276559 2047 dbSNP
rs1363335809 2054 dbSNP
rs1322581713 2060 dbSNP
rs1405764073 2061 dbSNP
rs1444127558 2065 dbSNP
rs549761431 2066 dbSNP
rs1392741240 2067 dbSNP
rs1185098300 2068 dbSNP
rs1367727611 2070 dbSNP
rs1166055220 2072 dbSNP
rs1475070996 2077 dbSNP
rs1387713288 2079 dbSNP
rs1422988748 2082 dbSNP
rs1428556558 2084 dbSNP
rs1313017565 2086 dbSNP
rs1404981441 2093 dbSNP
rs1394843953 2100 dbSNP
rs1327413297 2103 dbSNP
rs1333901030 2103 dbSNP
rs1433111026 2104 dbSNP
rs1295687019 2109 dbSNP
rs886394615 2119 dbSNP
rs1235102792 2123 dbSNP
rs1282608699 2126 dbSNP
rs1027538568 2127 dbSNP
rs1194556580 2129 dbSNP
rs1478885691 2132 dbSNP
rs1255163760 2138 dbSNP
rs1447367613 2139 dbSNP
rs1267050825 2144 dbSNP
rs1190038707 2145 dbSNP
rs994674514 2147 dbSNP
rs1448569747 2149 dbSNP
rs900184238 2149 dbSNP
rs1039082464 2159 dbSNP
rs1378908286 2159 dbSNP
rs1172539060 2162 dbSNP
rs1292537436 2164 dbSNP
rs1008669068 2166 dbSNP
rs1319035275 2172 dbSNP
rs1194574934 2186 dbSNP
rs890198679 2187 dbSNP
rs1053313868 2196 dbSNP
rs1317906102 2198 dbSNP
rs1303435609 2205 dbSNP
rs1278203672 2208 dbSNP
rs1219952338 2209 dbSNP
rs1230887778 2212 dbSNP
rs1255352815 2213 dbSNP
rs1351383023 2224 dbSNP
rs1210352066 2226 dbSNP
rs1266055383 2232 dbSNP
rs934823234 2239 dbSNP
rs181920097 2253 dbSNP
rs926068635 2255 dbSNP
rs1268792446 2262 dbSNP
rs1430957244 2279 dbSNP
rs1043345408 2280 dbSNP
rs1343204192 2282 dbSNP
rs1459349724 2287 dbSNP
rs948954233 2302 dbSNP
rs1295507284 2308 dbSNP
rs1388388731 2308 dbSNP
rs1462124120 2308 dbSNP
rs1388597277 2312 dbSNP
rs915941011 2318 dbSNP
rs1307880186 2322 dbSNP
rs993220548 2338 dbSNP
rs1436800876 2339 dbSNP
rs572412840 2356 dbSNP
rs2542774 2361 dbSNP
rs1221763182 2362 dbSNP
rs982798108 2380 dbSNP
rs1487336125 2381 dbSNP
rs1400942507 2388 dbSNP
rs1250671804 2395 dbSNP
rs1473827528 2401 dbSNP
rs950556152 2401 dbSNP
rs201916131 2412 dbSNP
rs1467265138 2415 dbSNP
rs1427340376 2420 dbSNP
rs1167420650 2422 dbSNP
rs994779876 2424 dbSNP
rs1478514725 2435 dbSNP
rs1298797532 2452 dbSNP
rs1248818448 2465 dbSNP
rs190666787 2468 dbSNP
rs1411544713 2490 dbSNP
rs1017309254 2492 dbSNP
rs2780130 2504 dbSNP
rs1008970840 2511 dbSNP
rs1314693403 2518 dbSNP
rs2780129 2522 dbSNP
rs890091634 2527 dbSNP
rs1243633979 2530 dbSNP
rs1052857790 2539 dbSNP
rs1483751110 2540 dbSNP
rs998579310 2544 dbSNP
rs1251707516 2548 dbSNP
rs1199940040 2549 dbSNP
rs1183931714 2569 dbSNP
rs1412140646 2572 dbSNP
rs558852710 2573 dbSNP
rs1171434486 2574 dbSNP
rs1392031168 2575 dbSNP
rs763497236 2588 dbSNP
rs1043232296 2590 dbSNP
rs1369874182 2601 dbSNP
rs1448724040 2606 dbSNP
rs1277359282 2607 dbSNP
rs575630744 2614 dbSNP
rs1395019856 2622 dbSNP
rs1297893159 2624 dbSNP
rs949021449 2627 dbSNP
rs1225537316 2628 dbSNP
rs1273335538 2631 dbSNP
rs1313275815 2632 dbSNP
rs2430862 2653 dbSNP
rs557271327 2660 dbSNP
rs1483132015 2663 dbSNP
rs1346767188 2678 dbSNP
rs538644897 2679 dbSNP
rs1057169793 2687 dbSNP
rs1187973271 2688 dbSNP
rs1377482580 2689 dbSNP
rs1395826548 2693 dbSNP
rs938692217 2696 dbSNP
rs908514098 2698 dbSNP
rs982848624 2706 dbSNP
rs760997017 2707 dbSNP
rs2430861 2709 dbSNP
rs1450426361 2711 dbSNP
rs920459297 2717 dbSNP
rs1366877818 2718 dbSNP
rs578063163 2724 dbSNP
rs1415189051 2725 dbSNP
rs1427543352 2748 dbSNP
rs533411885 2751 dbSNP
rs553238104 2769 dbSNP
rs1008773619 2772 dbSNP
rs954378753 2783 dbSNP
rs1209748884 2793 dbSNP
rs1031312760 2801 dbSNP
rs1463698521 2804 dbSNP
rs1188195404 2805 dbSNP
rs186416206 2807 dbSNP
rs1479054228 2820 dbSNP
rs904254049 2821 dbSNP
rs1021835655 2822 dbSNP
rs1390590755 2823 dbSNP
rs1455281059 2825 dbSNP
rs150136106 2826 dbSNP
rs1349898155 2829 dbSNP
rs1236378242 2830 dbSNP
rs1437972646 2831 dbSNP
rs894610177 2834 dbSNP
rs575919611 2837 dbSNP
rs1367482376 2840 dbSNP
rs1313522646 2844 dbSNP
rs1290548543 2849 dbSNP
rs1327529312 2853 dbSNP
rs549576955 2855 dbSNP
rs1208279453 2856 dbSNP
rs556241108 2856 dbSNP
rs1453605416 2864 dbSNP
rs1219421590 2871 dbSNP
rs1246249412 2873 dbSNP
rs537226622 2893 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uugauauGUUGGAG-GAUGGAGu 5'
                 ||| :|| ||||||| 
Target 5' ------uCAAGUUCACUACCUC- 3'
 		1 - 16
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000297814.2 | 3UTR | UCAAGUUCACUACCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000297814.2 | 3UTR | UCAAGUUCACUACCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.972 0.01 -1.000 0.5 4 Click to see details
THCA 0.279 0.02 0.333 0 59 Click to see details
LIHC -0.237 0.05 -0.159 0.14 49 Click to see details
PRAD 0.188 0.1 0.131 0.18 50 Click to see details
BLCA -0.307 0.11 -0.482 0.02 18 Click to see details
LUSC 0.201 0.11 0.131 0.22 38 Click to see details
LUAD 0.374 0.12 0.280 0.19 12 Click to see details
KIRP -0.188 0.15 -0.104 0.29 32 Click to see details
STAD 0.185 0.16 0.206 0.13 32 Click to see details
CHOL -0.357 0.17 -0.133 0.37 9 Click to see details
KIRC 0.101 0.21 0.046 0.35 68 Click to see details
PCPG 0.79 0.21 0.500 0.33 3 Click to see details
KICH -0.13 0.27 -0.156 0.23 25 Click to see details
COAD 0.219 0.3 -0.095 0.41 8 Click to see details
HNSC 0.06 0.35 -0.002 0.49 42 Click to see details
CESC -0.326 0.39 -0.500 0.33 3 Click to see details
BRCA -0.005 0.48 0.024 0.41 84 Click to see details
UCEC -0.011 0.48 0.037 0.44 19 Click to see details
ESCA 0.007 0.49 -0.227 0.25 11 Click to see details
ESCA 0.007 0.49 -0.227 0.25 11 Click to see details
ESCA 0.007 0.49 -0.227 0.25 11 Click to see details
581 hsa-let-7e-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002081 HMGA2 high mobility group AT-hook 2 5 5
MIRT003932 EIF3J eukaryotic translation initiation factor 3 subunit J 2 1
MIRT004469 SMC1A structural maintenance of chromosomes 1A 4 7
MIRT005718 WNT1 Wnt family member 1 4 1
MIRT006122 CCND1 cyclin D1 5 4
MIRT006404 MPL MPL proto-oncogene, thrombopoietin receptor 1 1
MIRT032098 RABGAP1L RAB GTPase activating protein 1 like 1 1
MIRT032099 DAD1 defender against cell death 1 1 1
MIRT032100 MYCN MYCN proto-oncogene, bHLH transcription factor 4 2
MIRT051413 WDR67 TBC1 domain family member 31 1 1
MIRT051414 FAM219B family with sequence similarity 219 member B 1 1
MIRT051415 C11orf91 chromosome 11 open reading frame 91 1 1
MIRT051416 CENPP centromere protein P 1 1
MIRT051417 TMEM107 transmembrane protein 107 1 1
MIRT051418 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT051419 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT051420 DGCR8 DGCR8, microprocessor complex subunit 1 1
MIRT051421 RAP1A RAP1A, member of RAS oncogene family 1 1
MIRT051422 RPA1 replication protein A1 1 1
MIRT051423 SKIV2L Ski2 like RNA helicase 1 1
MIRT051424 AGO1 argonaute 1, RISC catalytic component 4 2
MIRT051425 RPS27 ribosomal protein S27 1 1
MIRT051426 ARNT2 aryl hydrocarbon receptor nuclear translocator 2 1 1
MIRT051427 GPM6B glycoprotein M6B 1 1
MIRT051428 TTLL12 tubulin tyrosine ligase like 12 1 1
MIRT051429 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT051430 CELF2 CUGBP Elav-like family member 2 1 1
MIRT051431 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT051432 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT051433 RPL10 ribosomal protein L10 1 1
MIRT051434 SPCS2 signal peptidase complex subunit 2 1 1
MIRT051435 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT051436 CTC1 CST telomere replication complex component 1 1 1
MIRT051437 NAA60 N(alpha)-acetyltransferase 60, NatF catalytic subunit 1 1
MIRT051438 PHF3 PHD finger protein 3 1 1
MIRT051439 TUBA1B tubulin alpha 1b 1 1
MIRT051440 SHANK1 SH3 and multiple ankyrin repeat domains 1 1 1
MIRT051441 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT051442 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT051443 ND2 MTND2 1 1
MIRT051444 MED13L mediator complex subunit 13 like 1 1
MIRT051445 RCOR3 REST corepressor 3 1 1
MIRT051446 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT051447 RDX radixin 2 5
MIRT051448 PCBP2 poly(rC) binding protein 2 1 1
MIRT051449 UBAP2L ubiquitin associated protein 2 like 1 1
MIRT051450 CDCA3 cell division cycle associated 3 1 1
MIRT051451 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT051452 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT051453 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT051454 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051455 WBSCR16 RCC1 like 1 1
MIRT051456 SLC2A11 solute carrier family 2 member 11 1 1
MIRT051457 NF1 neurofibromin 1 1 1
MIRT051458 LRRC8A leucine rich repeat containing 8 VRAC subunit A 1 1
MIRT051459 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT051460 DTNB dystrobrevin beta 1 1
MIRT051461 SCMH1 Scm polycomb group protein homolog 1 1 1
MIRT051462 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT051463 RHBDD2 rhomboid domain containing 2 1 1
MIRT051464 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051465 NDST1 N-deacetylase and N-sulfotransferase 1 1 1
MIRT051466 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 5
MIRT051467 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT051468 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT051469 CARM1 coactivator associated arginine methyltransferase 1 1 1
MIRT051470 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT051471 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT051472 PIGS phosphatidylinositol glycan anchor biosynthesis class S 1 1
MIRT051473 ALG13 ALG13, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT051474 RPN2 ribophorin II 1 1
MIRT051475 RPL12 ribosomal protein L12 1 1
MIRT051476 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051477 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT051478 JAZF1 JAZF zinc finger 1 1 1
MIRT051479 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051480 VARS valyl-tRNA synthetase 1 1
MIRT051481 RNF26 ring finger protein 26 1 1
MIRT051482 LHFPL2 LHFPL tetraspan subfamily member 2 1 1
MIRT051483 ARCN1 archain 1 1 1
MIRT051484 COX1 cytochrome c oxidase subunit I 1 1
MIRT051485 SLC12A4 solute carrier family 12 member 4 1 1
MIRT051486 AEBP2 AE binding protein 2 1 1
MIRT051487 PET112 glutamyl-tRNA amidotransferase subunit B 1 1
MIRT051488 UROC1 urocanate hydratase 1 1 1
MIRT051489 IGF1R insulin like growth factor 1 receptor 5 10
MIRT051490 BSDC1 BSD domain containing 1 1 1
MIRT051491 PTK2 protein tyrosine kinase 2 1 1
MIRT051492 CDC5L cell division cycle 5 like 1 1
MIRT051493 EN2 engrailed homeobox 2 1 1
MIRT051494 SSB Sjogren syndrome antigen B 1 1
MIRT051495 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT051496 RRAGC Ras related GTP binding C 1 1
MIRT051497 ZNF236 zinc finger protein 236 1 1
MIRT051498 SEMA4B semaphorin 4B 1 1
MIRT051499 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT051500 XIAP X-linked inhibitor of apoptosis 1 1
MIRT051501 GTF2I general transcription factor IIi 1 1
MIRT051502 JMJD1C jumonji domain containing 1C 1 1
MIRT051503 OTUD5 OTU deubiquitinase 5 1 1
MIRT051504 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT051505 PPIG peptidylprolyl isomerase G 1 1
MIRT051506 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT051507 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT051508 VAMP2 vesicle associated membrane protein 2 1 1
MIRT051509 LSR lipolysis stimulated lipoprotein receptor 1 1
MIRT051510 KIAA0355 KIAA0355 1 1
MIRT051511 RPSA ribosomal protein SA 1 1
MIRT051512 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT051513 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT051514 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT051515 PIGP phosphatidylinositol glycan anchor biosynthesis class P 1 1
MIRT051516 LMLN leishmanolysin like peptidase 1 1
MIRT051517 PPP2R1A protein phosphatase 2 scaffold subunit Aalpha 1 1
MIRT051518 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT051519 SERF2 small EDRK-rich factor 2 1 1
MIRT051520 RBM4 RNA binding motif protein 4 1 1
MIRT051521 RBM14 RNA binding motif protein 14 1 1
MIRT051522 HMGB1 high mobility group box 1 1 1
MIRT051523 GMPS guanine monophosphate synthase 1 1
MIRT051524 DIAPH1 diaphanous related formin 1 1 1
MIRT051525 STAM signal transducing adaptor molecule 1 1
MIRT051526 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT051527 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 1 1
MIRT051528 MARCH5 membrane associated ring-CH-type finger 5 1 1
MIRT051529 SQLE squalene epoxidase 1 1
MIRT051530 TIMM50 translocase of inner mitochondrial membrane 50 1 1
MIRT051531 NDUFA3 NADH:ubiquinone oxidoreductase subunit A3 1 1
MIRT051532 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 1 1
MIRT051533 NRSN2 neurensin 2 1 1
MIRT051534 SALL1 spalt like transcription factor 1 1 1
MIRT051535 COX3 cytochrome c oxidase III 1 1
MIRT051536 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT051537 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT051538 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT051539 MTMR14 myotubularin related protein 14 1 1
MIRT051540 LUZP1 leucine zipper protein 1 1 1
MIRT051541 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT051542 SUZ12 SUZ12 polycomb repressive complex 2 subunit 1 1
MIRT051543 PAPD4 poly(A) RNA polymerase D4, non-canonical 1 1
MIRT051544 QSOX1 quiescin sulfhydryl oxidase 1 1 1
MIRT051545 SPATA13 spermatogenesis associated 13 1 1
MIRT051546 DHX57 DExH-box helicase 57 1 1
MIRT051547 KATNB1 katanin regulatory subunit B1 1 1
MIRT051548 COL6A1 collagen type VI alpha 1 chain 1 1
MIRT051549 DHX15 DEAH-box helicase 15 1 1
MIRT051550 MTCH2 mitochondrial carrier 2 1 1
MIRT051551 KIAA0100 KIAA0100 1 1
MIRT051552 SUGP2 SURP and G-patch domain containing 2 1 1
MIRT051553 NCLN nicalin 1 1
MIRT051554 ATXN2L ataxin 2 like 1 1
MIRT051555 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT051556 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT051557 NUP155 nucleoporin 155 2 7
MIRT051558 GNG5 G protein subunit gamma 5 2 3
MIRT051559 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT051560 MTFR1 mitochondrial fission regulator 1 1 1
MIRT051561 IRS2 insulin receptor substrate 2 2 1
MIRT051562 IRS4 insulin receptor substrate 4 1 1
MIRT051563 PPP1R10 protein phosphatase 1 regulatory subunit 10 1 1
MIRT051564 ZNF284 zinc finger protein 284 1 1
MIRT051565 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT051566 SCD stearoyl-CoA desaturase 1 1
MIRT051567 FDPS farnesyl diphosphate synthase 1 1
MIRT051568 KRBOX4 KRAB box domain containing 4 1 1
MIRT051569 BRI3 brain protein I3 1 1
MIRT051570 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT051571 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT051572 SMAP2 small ArfGAP2 1 1
MIRT051573 WDFY3 WD repeat and FYVE domain containing 3 1 1
MIRT051574 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT051575 SRSF2 serine and arginine rich splicing factor 2 1 1
MIRT051576 PGD phosphogluconate dehydrogenase 1 1
MIRT051577 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT051578 ZNF652 zinc finger protein 652 1 1
MIRT051579 PSMA6 proteasome subunit alpha 6 1 1
MIRT051580 SLC38A2 solute carrier family 38 member 2 1 1
MIRT051581 LRRC41 leucine rich repeat containing 41 1 1
MIRT051582 RANBP2 RAN binding protein 2 1 1
MIRT051583 SVIL supervillin 1 1
MIRT051584 CCNG1 cyclin G1 1 1
MIRT051585 ZNF256 zinc finger protein 256 1 1
MIRT051586 COPG1 coatomer protein complex subunit gamma 1 1 1
MIRT051587 PDCD11 programmed cell death 11 1 1
MIRT051588 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT051589 USP37 ubiquitin specific peptidase 37 1 1
MIRT051590 UBE2V2 ubiquitin conjugating enzyme E2 V2 1 1
MIRT051591 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT051592 LMNA lamin A/C 1 1
MIRT051593 STAT3 signal transducer and activator of transcription 3 1 1
MIRT051594 TRPV1 transient receptor potential cation channel subfamily V member 1 1 1
MIRT051595 MATR3 matrin 3 1 1
MIRT051596 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT051597 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT051598 WDR48 WD repeat domain 48 1 1
MIRT051599 RBM8A RNA binding motif protein 8A 1 1
MIRT051600 SCYL1 SCY1 like pseudokinase 1 1 1
MIRT051601 C19orf48 chromosome 19 open reading frame 48 1 1
MIRT051602 FOXD4L6 forkhead box D4 like 6 1 1
MIRT051603 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT051604 SPCS3 signal peptidase complex subunit 3 1 1
MIRT051605 TNFAIP1 TNF alpha induced protein 1 1 1
MIRT051606 MS4A10 membrane spanning 4-domains A10 1 1
MIRT051607 MSMO1 methylsterol monooxygenase 1 1 1
MIRT051608 ARID1A AT-rich interaction domain 1A 1 1
MIRT051609 NCKIPSD NCK interacting protein with SH3 domain 2 5
MIRT051610 NCBP1 nuclear cap binding protein subunit 1 1 1
MIRT051611 COX16 COX16, cytochrome c oxidase assembly homolog 1 1
MIRT051612 NUDT8 nudix hydrolase 8 1 1
MIRT051613 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT051614 TXNRD1 thioredoxin reductase 1 1 1
MIRT051615 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT051616 CTSA cathepsin A 1 1
MIRT051617 PRRC2A proline rich coiled-coil 2A 1 1
MIRT051618 SPAG9 sperm associated antigen 9 1 1
MIRT051619 AGMAT agmatinase 1 1
MIRT051620 NCKAP5L NCK associated protein 5 like 1 1
MIRT051621 ZFP62 ZFP62 zinc finger protein 1 1
MIRT051622 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT051623 POLR3D RNA polymerase III subunit D 2 3
MIRT051624 PRPF8 pre-mRNA processing factor 8 1 1
MIRT051625 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051626 ZFAND5 zinc finger AN1-type containing 5 1 1
MIRT051627 BAZ1B bromodomain adjacent to zinc finger domain 1B 1 1
MIRT051628 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT051629 BMP2K BMP2 inducible kinase 1 1
MIRT051630 SPN sialophorin 1 1
MIRT051631 PA2G4 proliferation-associated 2G4 1 1
MIRT051632 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT051633 TUBB4B tubulin beta 4B class IVb 1 1
MIRT051634 TRRAP transformation/transcription domain associated protein 1 1
MIRT051635 SLCO4A1 solute carrier organic anion transporter family member 4A1 1 1
MIRT051636 CCRN4L nocturnin 1 1
MIRT051637 USE1 unconventional SNARE in the ER 1 1 1
MIRT051638 STARD7 StAR related lipid transfer domain containing 7 1 1
MIRT051639 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 3
MIRT051640 CLTC clathrin heavy chain 1 1
MIRT051641 TERF1 telomeric repeat binding factor 1 1 1
MIRT051642 PAX3 paired box 3 1 1
MIRT051643 CCDC97 coiled-coil domain containing 97 1 1
MIRT051644 HLA-C major histocompatibility complex, class I, C 1 1
MIRT051645 GTPBP8 GTP binding protein 8 (putative) 1 1
MIRT051646 VGLL4 vestigial like family member 4 1 1
MIRT051647 ANKRD40 ankyrin repeat domain 40 1 1
MIRT051648 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT051649 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051650 DSP desmoplakin 1 1
MIRT051651 UBN2 ubinuclein 2 1 1
MIRT051652 ZNF805 zinc finger protein 805 1 1
MIRT051653 RBBP4 RB binding protein 4, chromatin remodeling factor 1 1
MIRT051654 OCLN occludin 1 1
MIRT051655 CBX5 chromobox 5 2 3
MIRT051656 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT051657 MKI67 marker of proliferation Ki-67 1 1
MIRT051658 SUB1 SUB1 homolog, transcriptional regulator 1 1
MIRT051659 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051660 SEC23IP SEC23 interacting protein 1 1
MIRT051661 RNMT RNA guanine-7 methyltransferase 1 1
MIRT051662 SGSM3 small G protein signaling modulator 3 1 1
MIRT051663 ZFP3 ZFP3 zinc finger protein 1 1
MIRT051664 GLUL glutamate-ammonia ligase 1 1
MIRT051665 POLD1 DNA polymerase delta 1, catalytic subunit 1 1
MIRT051666 WDR4 WD repeat domain 4 1 1
MIRT051667 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT051668 RAI2 retinoic acid induced 2 1 1
MIRT051669 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 1 1
MIRT051670 UTP15 UTP15, small subunit processome component 1 1
MIRT051671 THADA THADA, armadillo repeat containing 1 1
MIRT051672 ZNF451 zinc finger protein 451 1 1
MIRT051673 CREBBP CREB binding protein 1 1
MIRT051674 ZNF770 zinc finger protein 770 1 1
MIRT051675 CLDN4 claudin 4 1 1
MIRT051676 ZKSCAN7 zinc finger with KRAB and SCAN domains 7 1 1
MIRT051677 NICN1 nicolin 1 1 1
MIRT051678 RPLP2 ribosomal protein lateral stalk subunit P2 1 1
MIRT051679 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT051680 IRGQ immunity related GTPase Q 1 1
MIRT051681 CA5B carbonic anhydrase 5B 1 1
MIRT051682 COX14 COX14, cytochrome c oxidase assembly factor 1 1
MIRT051683 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT051684 RPL27A ribosomal protein L27a 1 1
MIRT051685 CWC15 CWC15 spliceosome associated protein homolog 1 1
MIRT051686 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051687 OR7D2 olfactory receptor family 7 subfamily D member 2 1 1
MIRT051688 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT051689 NUDT15 nudix hydrolase 15 1 1
MIRT051690 CDH18 cadherin 18 1 1
MIRT051691 FAM160B1 family with sequence similarity 160 member B1 1 1
MIRT051692 DZIP1 DAZ interacting zinc finger protein 1 1 1
MIRT051693 TDRD7 tudor domain containing 7 1 1
MIRT051694 TCF4 transcription factor 4 1 1
MIRT051695 ENSA endosulfine alpha 1 1
MIRT051696 GTF3C1 general transcription factor IIIC subunit 1 1 1
MIRT051697 TNFRSF1A TNF receptor superfamily member 1A 1 1
MIRT051698 CCDC113 coiled-coil domain containing 113 1 1
MIRT051699 MYO9B myosin IXB 1 1
MIRT051700 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 1 1
MIRT051701 PRAMEF13 PRAME family member 13 1 1
MIRT051702 PMPCA peptidase, mitochondrial processing alpha subunit 2 5
MIRT051703 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT051704 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT051705 CCDC106 coiled-coil domain containing 106 1 1
MIRT051706 CYP2B6 cytochrome P450 family 2 subfamily B member 6 1 1
MIRT051707 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 3
MIRT051708 PSME4 proteasome activator subunit 4 1 1
MIRT051709 SETD1A SET domain containing 1A 1 1
MIRT054561 MMP9 matrix metallopeptidase 9 3 1
MIRT054579 IGF1 insulin like growth factor 1 3 1
MIRT063195 ADIPOR2 adiponectin receptor 2 2 2
MIRT065687 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT067399 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068154 TXLNA taxilin alpha 2 2
MIRT068528 NHLRC3 NHL repeat containing 3 2 6
MIRT068789 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073006 ARID3B AT-rich interaction domain 3B 2 6
MIRT076223 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT077616 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT080398 ONECUT2 one cut homeobox 2 2 2
MIRT083300 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084976 BACH1 BTB domain and CNC homolog 1 2 2
MIRT094160 PCGF3 polycomb group ring finger 3 2 6
MIRT094460 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT095766 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT100094 ABT1 activator of basal transcription 1 2 8
MIRT112242 MDM4 MDM4, p53 regulator 2 4
MIRT118586 STK4 serine/threonine kinase 4 2 2
MIRT120921 PDE12 phosphodiesterase 12 2 8
MIRT123317 CALU calumenin 2 2
MIRT152272 TNFSF9 TNF superfamily member 9 2 2
MIRT153847 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168583 HMGA1 high mobility group AT-hook 1 2 4
MIRT180603 CRY2 cryptochrome circadian clock 2 2 2
MIRT187717 SUOX sulfite oxidase 2 2
MIRT191404 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193101 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215720 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218815 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240330 UBXN2B UBX domain protein 2B 2 2
MIRT243473 TRIM71 tripartite motif containing 71 2 2
MIRT244069 EDN1 endothelin 1 2 2
MIRT252330 SALL3 spalt like transcription factor 3 2 2
MIRT255314 CDV3 CDV3 homolog 2 2
MIRT259277 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259479 TXLNG taxilin gamma 2 2
MIRT260707 CLDN12 claudin 12 2 6
MIRT264693 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT266212 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266626 CHTOP chromatin target of PRMT1 2 2
MIRT268839 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT294446 ZNF264 zinc finger protein 264 2 2
MIRT297013 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT297443 SLC20A1 solute carrier family 20 member 1 2 4
MIRT300037 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300893 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303320 MXD1 MAX dimerization protein 1 2 2
MIRT309846 NAT8L N-acetyltransferase 8 like 2 2
MIRT322428 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324731 ACER2 alkaline ceramidase 2 2 2
MIRT402057 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437395 LIN28A lin-28 homolog A 4 1
MIRT437396 AURKB aurora kinase B 4 1
MIRT437435 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 2 1
MIRT438632 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT439135 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT442020 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445658 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447136 KIF27 kinesin family member 27 2 2
MIRT448259 ZNF774 zinc finger protein 774 2 2
MIRT449005 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449953 FMNL3 formin like 3 2 2
MIRT451155 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451624 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451693 C1RL complement C1r subcomponent like 2 2
MIRT452092 NUCB2 nucleobindin 2 2 2
MIRT452431 QDPR quinoid dihydropteridine reductase 2 2
MIRT452943 DISC1 disrupted in schizophrenia 1 2 2
MIRT453401 RHD Rh blood group D antigen 2 6
MIRT454164 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454280 FXN frataxin 2 2
MIRT454539 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454854 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455676 GLO1 glyoxalase I 2 2
MIRT457248 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457677 ZNF587 zinc finger protein 587 2 2
MIRT457887 THEM6 thioesterase superfamily member 6 2 4
MIRT458016 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458279 FUT10 fucosyltransferase 10 2 2
MIRT459736 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460453 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460500 FAM105A family with sequence similarity 105 member A 2 6
MIRT460938 NOA1 nitric oxide associated 1 2 4
MIRT461092 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461169 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461364 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462382 YAE1D1 Yae1 domain containing 1 2 2
MIRT462780 ZNF8 zinc finger protein 8 2 2
MIRT463420 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463662 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464265 VCL vinculin 2 2
MIRT465122 TSC22D2 TSC22 domain family member 2 2 4
MIRT466184 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466722 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469102 RNF144B ring finger protein 144B 2 2
MIRT469714 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470425 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470679 POLR2D RNA polymerase II subunit D 2 4
MIRT470861 PLXND1 plexin D1 2 2
MIRT471271 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471957 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472672 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT472739 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473134 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473234 SMCR7L mitochondrial elongation factor 1 1 4
MIRT473828 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473940 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474022 LRRC20 leucine rich repeat containing 20 2 2
MIRT474502 KLHDC8B kelch domain containing 8B 2 2
MIRT474766 KIAA0930 KIAA0930 2 2
MIRT474905 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475331 IFNLR1 interferon lambda receptor 1 2 2
MIRT475379 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475733 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476548 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476973 FAM83G family with sequence similarity 83 member G 2 4
MIRT477534 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT477682 EFHD2 EF-hand domain family member D2 2 2
MIRT481201 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481241 ATXN7L3 ataxin 7 like 3 2 2
MIRT481363 ATG9A autophagy related 9A 2 2
MIRT481388 ATG12 autophagy related 12 2 2
MIRT481652 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481851 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482184 AHR aryl hydrocarbon receptor 2 2
MIRT482220 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485296 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486659 ZNF28 zinc finger protein 28 2 2
MIRT489413 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491867 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492216 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492626 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493323 LIMD2 LIM domain containing 2 2 2
MIRT493901 FAM43A family with sequence similarity 43 member A 2 4
MIRT494263 CEP120 centrosomal protein 120 2 2
MIRT494687 ARID3A AT-rich interaction domain 3A 2 2
MIRT495968 TBC1D19 TBC1 domain family member 19 2 2
MIRT496111 SNX17 sorting nexin 17 2 2
MIRT497875 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498122 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499405 PLCG2 phospholipase C gamma 2 2 4
MIRT499493 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499653 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499942 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499997 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500819 THBS1 thrombospondin 1 2 3
MIRT500902 STRN striatin 2 4
MIRT501118 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501173 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501202 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501241 SEMA4C semaphorin 4C 2 6
MIRT501328 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501355 RNF44 ring finger protein 44 2 4
MIRT501387 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501441 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501759 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501943 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502106 KPNA5 karyopherin subunit alpha 5 2 8
MIRT502130 KMT2D lysine methyltransferase 2D 2 4
MIRT502784 CEP135 centrosomal protein 135 2 2
MIRT502845 CELF1 CUGBP Elav-like family member 1 2 2
MIRT504789 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT505017 ZNF644 zinc finger protein 644 2 2
MIRT506942 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507252 FIGN fidgetin, microtubule severing factor 2 8
MIRT507694 COIL coilin 2 6
MIRT508401 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508665 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508932 AK4 adenylate kinase 4 2 4
MIRT510395 ZNF566 zinc finger protein 566 2 6
MIRT510518 YOD1 YOD1 deubiquitinase 2 6
MIRT511386 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512745 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515954 C9orf156 tRNA methyltransferase O 2 2
MIRT516083 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT523619 FZD9 frizzled class receptor 9 2 4
MIRT523733 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523990 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524113 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525727 SOD2 superoxide dismutase 2 2 2
MIRT527763 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529727 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533187 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536378 LEFTY1 left-right determination factor 1 2 2
MIRT543785 RBM12B RNA binding motif protein 12B 2 4
MIRT543868 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545387 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545890 ZNF200 zinc finger protein 200 2 4
MIRT546334 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547373 MSI2 musashi RNA binding protein 2 2 2
MIRT547579 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548264 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548351 EPHA4 EPH receptor A4 2 2
MIRT548534 DUSP1 dual specificity phosphatase 1 2 2
MIRT548560 DNAL1 dynein axonemal light chain 1 2 2
MIRT548779 COLEC12 collectin subfamily member 12 2 2
MIRT548978 CCNT2 cyclin T2 2 2
MIRT549208 BEND4 BEN domain containing 4 2 4
MIRT549763 ZNF611 zinc finger protein 611 2 6
MIRT549799 KIAA0391 KIAA0391 2 2
MIRT549847 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550898 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551283 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551318 GSG2 histone H3 associated protein kinase 2 6
MIRT551932 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552003 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552410 ZNF460 zinc finger protein 460 2 4
MIRT553013 USP38 ubiquitin specific peptidase 38 2 2
MIRT555550 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555711 PDZD8 PDZ domain containing 8 2 2
MIRT557372 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557960 FAM222B family with sequence similarity 222 member B 2 2
MIRT559087 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559497 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561772 PEG10 paternally expressed 10 2 2
MIRT564402 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565443 SURF4 surfeit 4 2 2
MIRT566518 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567715 E2F6 E2F transcription factor 6 2 2
MIRT568655 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569498 THYN1 thymocyte nuclear protein 1 2 2
MIRT573820 TGOLN2 trans-golgi network protein 2 2 2
MIRT574363 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574750 GOLGA4 golgin A4 2 2
MIRT574788 FAM104A family with sequence similarity 104 member A 2 2
MIRT576089 Poteg POTE ankyrin domain family, member G 2 2
MIRT576812 Thbs1 thrombospondin 1 2 3
MIRT616370 RWDD1 RWD domain containing 1 2 2
MIRT617851 FMO4 flavin containing monooxygenase 4 2 2
MIRT642394 ZNF556 zinc finger protein 556 2 2
MIRT680519 PRIM2 DNA primase subunit 2 2 2
MIRT680547 ZNF584 zinc finger protein 584 2 2
MIRT680800 ZNF578 zinc finger protein 578 2 2
MIRT680838 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681141 INTS7 integrator complex subunit 7 2 2
MIRT681271 RFC2 replication factor C subunit 2 2 2
MIRT681323 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681359 BRI3BP BRI3 binding protein 2 2
MIRT681506 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681536 ZNF738 zinc finger protein 738 2 2
MIRT681658 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681738 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681797 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681869 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681941 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682102 ITGA3 integrin subunit alpha 3 2 4
MIRT682181 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682238 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682384 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682444 MTX3 metaxin 3 2 2
MIRT682604 CPA4 carboxypeptidase A4 2 2
MIRT682640 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689327 FPR1 formyl peptide receptor 1 2 2
MIRT689730 ATXN2 ataxin 2 2 2
MIRT691036 ZNF799 zinc finger protein 799 2 2
MIRT691935 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694884 ZNF417 zinc finger protein 417 2 2
MIRT695255 ZNF443 zinc finger protein 443 2 2
MIRT695413 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700589 PRSS22 protease, serine 22 2 2
MIRT701428 NHLRC2 NHL repeat containing 2 2 2
MIRT702484 KIAA1328 KIAA1328 2 2
MIRT702715 IPO9 importin 9 2 2
MIRT704028 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704418 CTPS1 CTP synthase 1 2 2
MIRT705750 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712373 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713520 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT731263 FASLG Fas ligand 3 1
MIRT732697 Ccr7 chemokine (C-C motif) receptor 7 2 0
MIRT732700 Snhg12 small nucleolar RNA host gene 12 2 0
MIRT734626 SYT7 synaptotagmin 7 1 0
MIRT755829 UBQLN4 ubiquilin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7e Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
let-7e Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7e Doxorubicin approved 31703 Microarray ovarian cancer 19237188 2009 up-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7e Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 up-regulated
let-7e Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7e 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
let-7e Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
let-7e Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7e Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
let-7e 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
let-7e Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (A2780)
hsa-let-7e Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-let-7e Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780, HO8910, ES2, CAOV3, SKOV3)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-8)
hsa-let-7e Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7C)
hsa-let-7e Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7e Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-let-7e Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-let-7e 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-let-7e Ethanol+Tamoxifen resistant cell line (LY2)
hsa-let-7e Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-let-7e Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7e Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7e Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (OE19)
hsa-let-7e Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-let-7e Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-let-7e-5p Alvocidib 5287969 NSC649890 resistant
hsa-let-7e-5p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-let-7e-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7e-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-let-7e-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-let-7e-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7e-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-let-7e-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (clear cell renal cell carcinoma)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-let-7e-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission