miRTarBase - #MIRT447596


—
pre-miRNA Information
pre-miRNA hsa-mir-1246   
Genomic Coordinates chr2: 176600980 - 176601052
Synonyms MIRN1246, hsa-mir-1246, MIR1246
Description Homo sapiens miR-1246 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1246
Sequence 11| AAUGGAUUUUUGGAGCAGG |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1489969781 2 dbSNP
rs757265617 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MSH3   
Synonyms DUP, FAP4, MRP1
Description mutS homolog 3
Transcript NM_002439   
Expression
Putative miRNA Targets on MSH3
3'UTR of MSH3
(miRNA target sites are highlighted)		 
>MSH3|NM_002439|3'UTR
   1 AATGAAGACTACATTTGTGAACAAAAAATGGAGAATTAAAAATACCAACTGTACAAAATAACTCTCCAGTAACAGCCTAT
  81 CTTTGTGTGACATGTGAGCATAAAATTATGACCATGGTATATTCCTATTGGAAACAGAGAGGTTTTTCTGAAGACAGTCT
 161 TTTTCAAGTTTCTGTCTTCCTAACTTTTCTACGTATAAACACTCTTGAATAGACTTCCACTTTGTAATTAGAAAATTTTA
 241 TGGACAGTAAGTCCAGTAAAGCCTTAAGTGGCAGAATATAATTCCCAAGCTTTTGGAGGGTGATATAAAAATTTACTTGA
 321 TATTTTTATTTGTTTCAGTTCAGATAATTGGCAACTGGGTGAATCTGGCAGGAATCTATCCATTGAACTAAAATAATTTT
 401 ATTATGCAACCAGTTTATCCACCAAGAACATAAGAATTTTTTATAAGTAGAAAGAATTGGCCAGGCATGGTGGCTCATGC
 481 CTGTAATCCCAGCACTTTGGGAGGCCAAGGTAGGCAGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGG
 561 CAAAACCCCATCTTTACTAAAAATATAAAGTACATCTCTACTAAAAATACGAAAAAATTAGCTGGGCATGGTGGCGCACA
 641 CCTGTAGTCCCAGCTACTCCGGAGGCTGAGGCAGGAGAATCTCTTGAACCTGGGAGGCGGAGGTTGCAATGAGCCGAGAT
 721 CACGTCACTGCACTCCAGCTTGGGCAACAGAGCAAGACTCCATCTCAAAAAAAAAAAAAGAAAAAAGAAAAGAAATAGAA
 801 TTATCAAGCTTTTAAAAACTAGAGCACAGAAGGAATAAGGTCATGAAATTTAAAAGGTTAAATATTGTCATAGGATTAAG
 881 CAGTTTAAAGATTGTTGGATGAAATTATTTGTCATTCATTCAAGTAATAAATATTTAATGAATACTTGCTATAAAAAAAA
 961 AAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggacgagGUUUUUAGGUAa 5'
                 ||::||||:|| 
Target 5' aatctggCAGGAATCTATc 3'
 362 - 380 136.00 -11.40
2 
miRNA  3' ggacgagGUUUUUAGGUAa 5'
                 |||:| ||||| 
Target 5' aacagagCAAGACTCCATc 3'
 746 - 764 124.00 -8.00
3 
miRNA  3' ggACGAGGUUUUUAGGUaa 5'
            ||  | : ||:||||  
Target 5' taTGGACAGTAAGTCCAgt 3'
 239 - 257 113.00 -6.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30089752 109 COSMIC
COSN30165291 117 COSMIC
COSN31554469 123 COSMIC
COSN15660601 160 COSMIC
COSN19359608 375 COSMIC
COSN25884433 421 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1157745007 5 dbSNP
rs896789980 8 dbSNP
rs778453469 10 dbSNP
rs1174809748 13 dbSNP
rs1428785106 14 dbSNP
rs949708660 19 dbSNP
rs1304619138 20 dbSNP
rs1394447051 22 dbSNP
rs1390939370 23 dbSNP
rs1308523648 28 dbSNP
rs1045470342 31 dbSNP
rs1477345599 32 dbSNP
rs555172563 37 dbSNP
rs763210205 40 dbSNP
rs778368057 43 dbSNP
rs747382686 46 dbSNP
rs771417913 47 dbSNP
rs781625455 49 dbSNP
rs764617904 51 dbSNP
rs896110227 56 dbSNP
rs1014915062 75 dbSNP
rs774078017 79 dbSNP
rs373530451 80 dbSNP
rs1047247009 81 dbSNP
rs887256618 86 dbSNP
rs1005274948 95 dbSNP
rs1016608288 96 dbSNP
rs1463930280 98 dbSNP
rs1366832304 99 dbSNP
rs1275423037 101 dbSNP
rs963688494 107 dbSNP
rs892978612 120 dbSNP
rs1292173916 121 dbSNP
rs1370669975 122 dbSNP
rs996486774 128 dbSNP
rs1029738952 134 dbSNP
rs966641380 136 dbSNP
rs955350818 137 dbSNP
rs976719575 165 dbSNP
rs1029654276 173 dbSNP
rs1214123929 188 dbSNP
rs1193163145 189 dbSNP
rs371112264 191 dbSNP
rs1288178604 192 dbSNP
rs913755734 194 dbSNP
rs967844966 195 dbSNP
rs1311746370 202 dbSNP
rs910027954 205 dbSNP
rs761583213 206 dbSNP
rs1338088813 244 dbSNP
rs867818453 254 dbSNP
rs1271070480 268 dbSNP
rs972976685 269 dbSNP
rs1277364589 270 dbSNP
rs925990011 289 dbSNP
rs143087023 291 dbSNP
rs1446651908 292 dbSNP
rs1055835475 307 dbSNP
rs564103251 314 dbSNP
rs917228149 321 dbSNP
rs1474185362 323 dbSNP
rs905550569 337 dbSNP
rs41561315 356 dbSNP
rs1170424436 373 dbSNP
rs1478384836 383 dbSNP
rs546564424 390 dbSNP
rs563061406 391 dbSNP
rs1419549004 392 dbSNP
rs41563313 405 dbSNP
rs887287544 414 dbSNP
rs1005641394 422 dbSNP
rs1238146135 432 dbSNP
rs982184471 433 dbSNP
rs569517915 435 dbSNP
rs996992768 446 dbSNP
rs1257130298 447 dbSNP
rs1219002553 455 dbSNP
rs1319816302 457 dbSNP
rs182471429 468 dbSNP
rs955191565 469 dbSNP
rs997419669 470 dbSNP
rs1304079879 473 dbSNP
rs1009500827 480 dbSNP
rs527652841 484 dbSNP
rs1020849875 489 dbSNP
rs1331334703 496 dbSNP
rs1466438906 500 dbSNP
rs547372858 501 dbSNP
rs1270866069 506 dbSNP
rs570541076 515 dbSNP
rs56009235 516 dbSNP
rs926437562 522 dbSNP
rs973309810 525 dbSNP
rs958849418 526 dbSNP
rs1237492754 527 dbSNP
rs1199240349 537 dbSNP
rs991962415 540 dbSNP
rs1458912345 544 dbSNP
rs1263483594 549 dbSNP
rs1321959298 567 dbSNP
rs1314498592 570 dbSNP
rs565498379 578 dbSNP
rs1291426328 589 dbSNP
rs1237317312 593 dbSNP
rs917273335 594 dbSNP
rs1214102071 597 dbSNP
rs950062632 604 dbSNP
rs981708488 611 dbSNP
rs1214588220 612 dbSNP
rs1457543973 622 dbSNP
rs1350674538 629 dbSNP
rs926917477 632 dbSNP
rs549705938 635 dbSNP
rs1486587892 636 dbSNP
rs394592 637 dbSNP
rs1420843420 638 dbSNP
rs1264926491 642 dbSNP
rs1209002668 645 dbSNP
rs1417854134 652 dbSNP
rs914302342 654 dbSNP
rs535311755 655 dbSNP
rs1214059163 658 dbSNP
rs1167566634 661 dbSNP
rs555405744 662 dbSNP
rs1241425194 668 dbSNP
rs945852503 673 dbSNP
rs56143166 675 dbSNP
rs1319274533 685 dbSNP
rs1386560543 696 dbSNP
rs1038537495 697 dbSNP
rs899986004 699 dbSNP
rs1418127295 700 dbSNP
rs997367369 701 dbSNP
rs932436793 703 dbSNP
rs1159337488 704 dbSNP
rs1051258101 707 dbSNP
rs890806750 709 dbSNP
rs1375852717 710 dbSNP
rs1198122571 712 dbSNP
rs34505312 714 dbSNP
rs754703397 714 dbSNP
rs1433531627 715 dbSNP
rs776205419 716 dbSNP
rs1009198563 717 dbSNP
rs889752915 719 dbSNP
rs1020632024 724 dbSNP
rs903807835 725 dbSNP
rs1342346736 726 dbSNP
rs1254739613 729 dbSNP
rs1000773870 733 dbSNP
rs963103446 738 dbSNP
rs1285622786 740 dbSNP
rs1294940845 741 dbSNP
rs1340101511 746 dbSNP
rs994285258 748 dbSNP
rs1383963223 762 dbSNP
rs1400217305 763 dbSNP
rs1171879112 766 dbSNP
rs1316710520 767 dbSNP
rs1431070776 767 dbSNP
rs1440176540 767 dbSNP
rs1477406679 767 dbSNP
rs201346044 767 dbSNP
rs576429943 767 dbSNP
rs71879707 767 dbSNP
rs77955797 767 dbSNP
rs79921566 768 dbSNP
rs1462162866 774 dbSNP
rs778691623 774 dbSNP
rs1265599283 775 dbSNP
rs1217175099 776 dbSNP
rs1317732647 778 dbSNP
rs1229913680 780 dbSNP
rs1279047769 780 dbSNP
rs1338734261 781 dbSNP
rs1025792121 785 dbSNP
rs1396484735 786 dbSNP
rs534735188 787 dbSNP
rs1329274965 788 dbSNP
rs991599985 790 dbSNP
rs1284585302 801 dbSNP
rs927532402 801 dbSNP
rs1024775290 809 dbSNP
rs971423344 820 dbSNP
rs531195404 825 dbSNP
rs1367335020 828 dbSNP
rs1318344247 829 dbSNP
rs1208102022 831 dbSNP
rs1187661371 833 dbSNP
rs1256122636 834 dbSNP
rs1486296739 836 dbSNP
rs1190645806 838 dbSNP
rs1197369695 839 dbSNP
rs982784814 840 dbSNP
rs1197735880 850 dbSNP
rs959025270 856 dbSNP
rs990213360 864 dbSNP
rs908541726 865 dbSNP
rs1306971909 868 dbSNP
rs1445968785 872 dbSNP
rs116383327 891 dbSNP
rs935299997 894 dbSNP
rs974273529 895 dbSNP
rs1159507210 897 dbSNP
rs192540928 899 dbSNP
rs1041466353 902 dbSNP
rs1163551499 912 dbSNP
rs1445912681 912 dbSNP
rs554168257 931 dbSNP
rs1050870145 935 dbSNP
rs1050267191 940 dbSNP
rs1233764396 946 dbSNP
rs1184400845 950 dbSNP
rs1450284288 952 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggacgagguUUUUAGGUAa 5'
                   ||:|||||| 
Target 5' -------ucAAGAUCCAUa 3'
 		1 - 12
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000265081.6 | 3UTR | UCAAGAUCCAUACAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000265081.6 | 3UTR | UCAAGAUCCAUACAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.516 5.9e-3 -0.436 1.9e-2 23 Click to see details
GSE28544 Breast cancer -0.478 9.1e-3 -0.509 5.5e-3 24 Click to see details
GSE28260 Renal cortex and medulla 0.273 1.8e-1 0.077 4.0e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells 0.125 2.8e-1 0.160 2.3e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.079 3.5e-1 -0.201 1.7e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.033 4.3e-1 0.022 4.5e-1 32 Click to see details
GSE38226 Liver fibrosis -0.002 5.0e-1 0.059 4.0e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.132 0.4 0.200 0.35 6 Click to see details
HNSC 0.132 0.4 0.200 0.35 6 Click to see details
HNSC 0.132 0.4 0.200 0.35 6 Click to see details
52 hsa-miR-1246 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053774 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 4 1
MIRT196431 TAOK1 TAO kinase 1 2 6
MIRT444394 ZNF480 zinc finger protein 480 2 2
MIRT447596 MSH3 mutS homolog 3 2 2
MIRT454049 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT458257 ZNF85 zinc finger protein 85 2 2
MIRT461493 KIAA1009 centrosomal protein 162 1 1
MIRT474057 LMNB2 lamin B2 2 2
MIRT479231 CKS2 CDC28 protein kinase regulatory subunit 2 2 6
MIRT485663 CHD7 chromodomain helicase DNA binding protein 7 2 2
MIRT485735 CALM2 calmodulin 2 2 2
MIRT498809 SRRT serrate, RNA effector molecule 2 8
MIRT501190 SKIL SKI like proto-oncogene 2 2
MIRT502619 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 6
MIRT502665 CTC1 CST telomere replication complex component 1 2 13
MIRT512313 ADCY9 adenylate cyclase 9 2 6
MIRT513756 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT514651 CRADD CASP2 and RIPK1 domain containing adaptor with death domain 2 2
MIRT514865 SHOX2 short stature homeobox 2 2 2
MIRT527109 ARHGAP15 Rho GTPase activating protein 15 2 2
MIRT527145 GPATCH11 G-patch domain containing 11 2 2
MIRT528507 HTR7 5-hydroxytryptamine receptor 7 2 4
MIRT532109 RRP8 ribosomal RNA processing 8 2 2
MIRT534601 RORA RAR related orphan receptor A 2 2
MIRT538906 BRI3BP BRI3 binding protein 2 4
MIRT544541 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT547430 MED4 mediator complex subunit 4 2 2
MIRT553029 USP48 ubiquitin specific peptidase 48 2 2
MIRT555136 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT562091 KIAA0895 KIAA0895 2 2
MIRT562584 CBX3 chromobox 3 2 4
MIRT563747 ZNF763 zinc finger protein 763 2 2
MIRT573310 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT687232 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT704465 CREBRF CREB3 regulatory factor 2 2
MIRT718817 PYGO1 pygopus family PHD finger 1 2 2
MIRT731194 NFIB nuclear factor I B 2 1
MIRT732503 SPRED2 sprouty related EVH1 domain containing 2 3 0
MIRT733489 MIF macrophage migration inhibitory factor 2 0
MIRT734071 SRSF1 serine and arginine rich splicing factor 1 2 0
MIRT734733 AR androgen receptor 3 0
MIRT734755 GLS2 glutaminase 2 2 0
MIRT735248 CFTR cystic fibrosis transmembrane conductance regulator 8 1
MIRT736017 ELAVL1 ELAV like RNA binding protein 1 2 0
MIRT736329 DNAH3 dynein axonemal heavy chain 3 2 0
MIRT737381 CCNG2 cyclin G2 2 0
MIRT755524 FOXA2 forkhead box A2 3 1
MIRT755713 DIXDC1 DIX domain containing 1 2 1
MIRT755714 WNT9A Wnt family member 9A 2 1
MIRT755715 RAC2 Rac family small GTPase 2 2 1
MIRT755716 FRAT2 FRAT2, WNT signaling pathway regulator 2 1
MIRT756132 ACE2 angiotensin I converting enzyme 2 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-1246 Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 up-regulated
miR-1246 Ascorbate approved 54670067 Microarray Metastatic melanoma cell lines 25202679 2014 up-regualted
miR-1246 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-1246 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miR-1246 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-1246 Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-1246 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-1246 Vincristine 5978 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1)
hsa-miR-1246 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Ductal Adenocarcinoma cell line (BxPC-3)
hsa-miR-1246 Bortezomib 387447 NSC681239 approved resistant High Multiple Myeloma cell line
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-1246 Plx-4720 24180719 NSC757438 resistant Low Melanoma cell line (A375P, SK-MEL-2)
hsa-miR-1246 Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (BCap37, Bads-200, Bats-72)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Epirubicin 41867 NSC256942 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, GNM, OC3, Fadu)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (200nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (200nM)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant Low Ovarian Cancer cell line (HeyA8, SKOV3, A2780, THP-1)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-1246 Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-1246 Erlotinib 176870 NSC718781 approved sensitive High Head And Neck Squamous Cell Carcinoma cell line (HN6)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (BCap37)
hsa-miR-1246 Trastuzumab resistant Low HER2-Positive Breast Cancer tissue
hsa-miR-1246 Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant Low Leukemia cell line (K562/ADM and HL-60/RS)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Melanoma cell line (A375)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved sensitive Low Breast Cancer tissue and cell line (MCF-7, MDA-MB-231, MDA-MB-468, SKBR3)
hsa-miR-1246 Antiepileptic Drug resistant High Pediatric Epilepsy tissue
hsa-mir-1246 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-mir-1246 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-1246 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1246 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-1246 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1246 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1246 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1246 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-1246 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1246 Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant cell line (K562)
hsa-miR-1246 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1246 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-1246 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission