miRTarBase - #MIRT448817


—
pre-miRNA Information
pre-miRNA hsa-mir-873   
Genomic Coordinates chr9: 28888879 - 28888955
Synonyms MIRN873, hsa-mir-873, MIR873
Description Homo sapiens miR-873 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-873-3p
Sequence 46| GGAGACUGAUGAGUUCCCGGGA |67
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760528397 3 dbSNP
rs773403294 9 dbSNP
rs1273846238 13 dbSNP
rs1339396073 15 dbSNP
rs1247999695 18 dbSNP
rs377380148 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FKBP1A   
Synonyms FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE
Description FK506 binding protein 1A
Transcript NM_000801   
Other Transcripts NM_054014   
Expression
Putative miRNA Targets on FKBP1A
3'UTR of FKBP1A
(miRNA target sites are highlighted)		 
>FKBP1A|NM_000801|3'UTR
   1 CAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAGACATGTGCACATGA
  81 ATCCATATGGAGCTTTTCCTGATGTTCCACTCCACTTTGTATAGACATCTGCCCTGACTGAATGTGTTCTGTCACTCAGC
 161 TTTGCTTCCGACACCTCTGTTTCCTCTTCCCCTTTCTCCTCGTATGTGTGTTTACCTAAACTATATGCCATAAACCTCAA
 241 GTTATTCATTTTATTTTGTTTTCATTTTGGGGTGAAGATTCAGTTTCAGTCTTTTGGATATAGGTTTCCAATTAAGTACA
 321 TGGTCAAGTATTAACAGCACAAGTGGTAGGTTAACATTAGAATAGGAATTGGTGTTGGGGGGGGGGTTTGCAAGAATATT
 401 TTATTTTAATTTTTTGGATGAAATTTTTATCTATTATATATTAAACATTCTTGCTGCTGCGCTGCAAAGCCATAGCAGAT
 481 TTGAGGCGCTGTTGAGGACTGAATTACTCTCCAAGTTGAGAGATGTCTTTGGGTTAAATTAAAAGCCCTACCTAAAACTG
 561 AGGTGGGGATGGGGAGAGCCTTTGCCTCCACCATTCCCACCCACCCTCCCCTTAAACCCTCTGCCTTTGAAAGTAGATCA
 641 TGTTCACTGCAATGCTGGACACTACAGGTATCTGTCCCTGGGCCAGCAGGGACCTCTGAAGCCTTCTTTGTGGCCTTTTT
 721 TTTTTTTCATCCTGTGGTTTTTCTAATGGACTTTCAGGAATTTTGTAATCTCATAACTTTCCAAGCTCCACCACTTCCTA
 801 AATCTTAAGAACTTTAATTGACAGTTTCAATTGAAGGTGCTGTTTGTAGACTTAACACCCAGTGAAAGCCCAGCCATCAT
 881 GACAAATCCTTGAATGTTCTCTTAAGAAAATGATGCTGGTCATCGCAGCTTCAGCATCTCCTGTTTTTTGATGCTTGGCT
 961 CCCTCTGCTGATCTCAGTTTCCTGGCTTTTCCTCCCTCAGCCCCTTCTCACCCCTTTGCTGTCCTGTGTAGTGATTTGGT
1041 GAGAAATCGTTGCTGCACCCTTCCCCCAGCACCATTTATGAGTCTCAAGTTTTATTATTGCAATAAAAGTGCTTTATGCC
1121 GGCTTTTCTCAGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agggCCC----UUGAGU---AGUCAGAGg 5'
              |||    :|:|||   |||||||: 
Target 5' tttgGGGTGAAGATTCAGTTTCAGTCTTt 3'
 266 - 294 140.00 -18.20
2 
miRNA  3' agggccCUUGAG--UA---GUCAGAGg 5'
                |||||:  ||   ||||:|| 
Target 5' tcttaaGAACTTTAATTGACAGTTTCa 3'
 803 - 829 138.00 -11.90
3 
miRNA  3' agGGCCCUUGAGUAGUCAGAGg 5'
            |:|  :| || |||||:|| 
Target 5' ctCTGCTGA-TC-TCAGTTTCc 3'
 963 - 982 134.00 -15.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN508282 6 COSMIC
COSN21101391 53 COSMIC
COSN31597900 61 COSMIC
COSN30455431 72 COSMIC
COSN30506581 81 COSMIC
COSN30146274 82 COSMIC
COSN30504794 88 COSMIC
COSN30539994 98 COSMIC
COSN20079712 137 COSMIC
COSN30144162 138 COSMIC
COSN30604181 141 COSMIC
COSN7996695 335 COSMIC
COSN1864999 1391 COSMIC
COSN15791127 1662 COSMIC
COSN9395785 1800 COSMIC
COSN24522373 1851 COSMIC
COSN24522372 1896 COSMIC
COSN30700599 1980 COSMIC
COSN15632046 2047 COSMIC
COSN22584121 2072 COSMIC
COSN29461856 2082 COSMIC
COSN28671098 2084 COSMIC
COSN18716634 2136 COSMIC
COSN30128734 2172 COSMIC
COSN26669012 2226 COSMIC
COSN23015465 2248 COSMIC
COSN16670532 2286 COSMIC
COSN22179274 2299 COSMIC
COSN26668131 2303 COSMIC
COSN20116199 2380 COSMIC
COSN16130673 2430 COSMIC
COSN31529437 2434 COSMIC
COSN31540379 2464 COSMIC
COSN19596901 2554 COSMIC
COSN31567830 2557 COSMIC
COSN31540386 2579 COSMIC
COSN30543520 2582 COSMIC
COSN30536300 2589 COSMIC
COSN20632018 2654 COSMIC
COSN31536866 2658 COSMIC
COSN20116197 2718 COSMIC
COSN31487025 2758 COSMIC
COSN30132178 2808 COSMIC
COSN30132181 2830 COSMIC
COSN30143875 2887 COSMIC
COSN8610482 2924 COSMIC
COSN28634282 2928 COSMIC
COSN31542939 2941 COSMIC
COSN20771054 3069 COSMIC
COSN26666739 3079 COSMIC
COSN30119695 3117 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747088929 3 dbSNP
rs1396215201 4 dbSNP
rs777836202 7 dbSNP
rs758493076 14 dbSNP
rs1382484572 16 dbSNP
rs758438227 18 dbSNP
rs1189943572 22 dbSNP
rs748425374 28 dbSNP
rs1310979517 31 dbSNP
rs1247635454 33 dbSNP
rs779111159 34 dbSNP
rs755342056 36 dbSNP
rs754306267 44 dbSNP
rs766982049 46 dbSNP
rs756749310 50 dbSNP
rs749882555 61 dbSNP
rs752771984 64 dbSNP
rs767064187 69 dbSNP
rs1387724053 70 dbSNP
rs931978249 76 dbSNP
rs552945753 77 dbSNP
rs966865292 79 dbSNP
rs1362781248 82 dbSNP
rs1322058027 85 dbSNP
rs761318984 91 dbSNP
rs1242837438 95 dbSNP
rs762834082 98 dbSNP
rs763693915 99 dbSNP
rs184089222 106 dbSNP
rs879187230 107 dbSNP
rs966506788 108 dbSNP
rs569192484 112 dbSNP
rs1001917033 118 dbSNP
rs552505934 127 dbSNP
rs1301897423 128 dbSNP
rs968297361 130 dbSNP
rs1450840887 138 dbSNP
rs1185672494 139 dbSNP
rs1366509769 140 dbSNP
rs1024899647 142 dbSNP
rs1294121180 145 dbSNP
rs538660594 149 dbSNP
rs1234061364 152 dbSNP
rs1461892278 154 dbSNP
rs993384931 157 dbSNP
rs897678969 158 dbSNP
rs1262945430 170 dbSNP
rs1037561019 180 dbSNP
rs1248374170 185 dbSNP
rs941827386 186 dbSNP
rs1184690633 187 dbSNP
rs1427271925 195 dbSNP
rs1319307327 196 dbSNP
rs1174764707 197 dbSNP
rs1285541005 206 dbSNP
rs112411527 213 dbSNP
rs775406393 215 dbSNP
rs536546656 221 dbSNP
rs1034415625 222 dbSNP
rs1287562876 226 dbSNP
rs1002666610 229 dbSNP
rs922568228 230 dbSNP
rs530238590 242 dbSNP
rs1282762747 243 dbSNP
rs573596162 247 dbSNP
rs36059165 253 dbSNP
rs1328894738 260 dbSNP
rs1230432970 264 dbSNP
rs1269070774 267 dbSNP
rs1004636542 294 dbSNP
rs914143656 296 dbSNP
rs2296039 297 dbSNP
rs1213393989 299 dbSNP
rs550775930 307 dbSNP
rs1488781474 311 dbSNP
rs887714819 319 dbSNP
rs1198022789 325 dbSNP
rs958444603 333 dbSNP
rs531068081 334 dbSNP
rs1159429969 335 dbSNP
rs6105016 339 dbSNP
rs1048937882 343 dbSNP
rs565239729 344 dbSNP
rs980895202 358 dbSNP
rs1352083158 359 dbSNP
rs1458835287 382 dbSNP
rs931880189 385 dbSNP
rs1303127526 389 dbSNP
rs1343702275 393 dbSNP
rs760850676 397 dbSNP
rs970431476 400 dbSNP
rs2296038 422 dbSNP
rs1289152332 424 dbSNP
rs1372891968 424 dbSNP
rs1221813532 430 dbSNP
rs1291806821 434 dbSNP
rs6041759 434 dbSNP
rs993143353 435 dbSNP
rs1289581682 436 dbSNP
rs897773655 437 dbSNP
rs1040773366 439 dbSNP
rs576754673 441 dbSNP
rs560128655 442 dbSNP
rs1183277470 443 dbSNP
rs1397594898 443 dbSNP
rs878863207 443 dbSNP
rs1425747360 447 dbSNP
rs944843515 454 dbSNP
rs1378553568 463 dbSNP
rs923988121 468 dbSNP
rs1165502428 469 dbSNP
rs888916003 477 dbSNP
rs775688506 478 dbSNP
rs1286224893 484 dbSNP
rs539929733 485 dbSNP
rs1245064840 489 dbSNP
rs932706905 493 dbSNP
rs537173605 520 dbSNP
rs6105015 528 dbSNP
rs1041054005 532 dbSNP
rs1435618315 541 dbSNP
rs112781253 545 dbSNP
rs1237758625 547 dbSNP
rs959870980 551 dbSNP
rs1352066292 561 dbSNP
rs1283301778 567 dbSNP
rs1445543338 569 dbSNP
rs1183384155 571 dbSNP
rs914195107 576 dbSNP
rs1359776052 580 dbSNP
rs6105014 583 dbSNP
rs1169043153 585 dbSNP
rs563775262 585 dbSNP
rs1313885525 586 dbSNP
rs1336398371 591 dbSNP
rs1407120235 591 dbSNP
rs771740738 592 dbSNP
rs926754889 612 dbSNP
rs980564471 613 dbSNP
rs970905942 622 dbSNP
rs1269580649 627 dbSNP
rs1002919698 630 dbSNP
rs1220454797 636 dbSNP
rs917658546 638 dbSNP
rs191687971 644 dbSNP
rs1460616372 648 dbSNP
rs1203393980 658 dbSNP
rs1241655768 659 dbSNP
rs961701324 666 dbSNP
rs1016200159 668 dbSNP
rs1006524439 670 dbSNP
rs1014603928 671 dbSNP
rs1430196189 675 dbSNP
rs953257756 685 dbSNP
rs878915385 692 dbSNP
rs77324343 701 dbSNP
rs1289163038 702 dbSNP
rs997347330 706 dbSNP
rs1358490898 719 dbSNP
rs1317468857 725 dbSNP
rs1305083602 731 dbSNP
rs527979609 738 dbSNP
rs1425342664 745 dbSNP
rs1048864417 749 dbSNP
rs1283405269 756 dbSNP
rs1221284678 769 dbSNP
rs1269693971 773 dbSNP
rs901300365 777 dbSNP
rs77748693 781 dbSNP
rs1430468781 782 dbSNP
rs1261575208 788 dbSNP
rs900408933 791 dbSNP
rs1445803532 793 dbSNP
rs1040383406 794 dbSNP
rs1201695204 796 dbSNP
rs1269668684 799 dbSNP
rs1420680638 799 dbSNP
rs1480183865 803 dbSNP
rs1009526191 806 dbSNP
rs759252617 807 dbSNP
rs892433029 811 dbSNP
rs1487608720 815 dbSNP
rs1271657597 822 dbSNP
rs1406988639 823 dbSNP
rs1303742225 827 dbSNP
rs1344312349 829 dbSNP
rs944665126 845 dbSNP
rs924038821 851 dbSNP
rs538954934 853 dbSNP
rs7271475 854 dbSNP
rs150388711 860 dbSNP
rs367707629 863 dbSNP
rs991389229 864 dbSNP
rs1212140030 866 dbSNP
rs1293224179 870 dbSNP
rs949569695 874 dbSNP
rs1197375911 875 dbSNP
rs1296053485 877 dbSNP
rs917710771 882 dbSNP
rs1181413281 884 dbSNP
rs1338387251 884 dbSNP
rs959658862 890 dbSNP
rs928170187 895 dbSNP
rs981152058 900 dbSNP
rs62187547 910 dbSNP
rs1309343223 911 dbSNP
rs138330484 934 dbSNP
rs1004613695 937 dbSNP
rs908857601 938 dbSNP
rs1304492202 941 dbSNP
rs1291796037 949 dbSNP
rs984456535 952 dbSNP
rs1218567893 954 dbSNP
rs953450131 961 dbSNP
rs1316271164 963 dbSNP
rs1028902930 968 dbSNP
rs531004820 977 dbSNP
rs1220295142 978 dbSNP
rs1253122255 980 dbSNP
rs1463754472 984 dbSNP
rs997799445 992 dbSNP
rs951796395 994 dbSNP
rs1248771748 1003 dbSNP
rs565514899 1006 dbSNP
rs1355287815 1007 dbSNP
rs1384484316 1036 dbSNP
rs746257682 1048 dbSNP
rs1170251614 1050 dbSNP
rs965812242 1052 dbSNP
rs770491539 1059 dbSNP
rs996378319 1064 dbSNP
rs1296019655 1068 dbSNP
rs1432170656 1069 dbSNP
rs892485363 1070 dbSNP
rs1337835994 1073 dbSNP
rs900418243 1076 dbSNP
rs1200766588 1084 dbSNP
rs1054219589 1086 dbSNP
rs1019254320 1099 dbSNP
rs778899872 1100 dbSNP
rs1226791598 1102 dbSNP
rs1008913716 1103 dbSNP
rs1045316315 1104 dbSNP
rs949532052 1117 dbSNP
rs565675117 1119 dbSNP
rs902542804 1123 dbSNP
rs1042392026 1131 dbSNP
rs1188198122 1136 dbSNP
rs1262349951 1140 dbSNP
rs541866079 1141 dbSNP
rs147053895 1149 dbSNP
rs946821825 1158 dbSNP
rs559866903 1159 dbSNP
rs1315819087 1166 dbSNP
rs1264706274 1168 dbSNP
rs1405796157 1170 dbSNP
rs940446901 1172 dbSNP
rs1055302052 1175 dbSNP
rs938154160 1186 dbSNP
rs1224048836 1189 dbSNP
rs112206153 1196 dbSNP
rs982803199 1202 dbSNP
rs1381671009 1210 dbSNP
rs1299314980 1211 dbSNP
rs1293563931 1216 dbSNP
rs1325806242 1228 dbSNP
rs540240322 1230 dbSNP
rs1224340974 1239 dbSNP
rs1262825903 1240 dbSNP
rs940260555 1244 dbSNP
rs781452743 1246 dbSNP
rs141671591 1248 dbSNP
rs1261185595 1253 dbSNP
rs34621638 1253 dbSNP
rs1485519189 1254 dbSNP
rs1184748272 1257 dbSNP
rs983069715 1272 dbSNP
rs757422077 1280 dbSNP
rs1464445953 1284 dbSNP
rs1027775525 1291 dbSNP
rs974618981 1295 dbSNP
rs1346269974 1299 dbSNP
rs187583080 1310 dbSNP
rs560971035 1311 dbSNP
rs1405631403 1314 dbSNP
rs1282816257 1318 dbSNP
rs975991516 1334 dbSNP
rs1225218243 1338 dbSNP
rs7353834 1347 dbSNP
rs1018767023 1348 dbSNP
rs544371451 1359 dbSNP
rs182894805 1370 dbSNP
rs1177551965 1385 dbSNP
rs1008841776 1393 dbSNP
rs902427531 1397 dbSNP
rs1469758259 1402 dbSNP
rs1376404768 1403 dbSNP
rs1020975830 1410 dbSNP
rs1221110027 1412 dbSNP
rs1266270830 1413 dbSNP
rs1020051385 1423 dbSNP
rs558741344 1433 dbSNP
rs1409149377 1446 dbSNP
rs6131418 1448 dbSNP
rs1418926663 1453 dbSNP
rs751809554 1456 dbSNP
rs893909905 1458 dbSNP
rs1032418542 1464 dbSNP
rs1001312018 1465 dbSNP
rs1444607057 1471 dbSNP
rs1280419397 1479 dbSNP
rs905150308 1485 dbSNP
rs1456121309 1488 dbSNP
rs1055590827 1490 dbSNP
rs1317004318 1501 dbSNP
rs1244783264 1502 dbSNP
rs1024313135 1509 dbSNP
rs938098490 1514 dbSNP
rs1439098780 1521 dbSNP
rs772611152 1521 dbSNP
rs1204768720 1523 dbSNP
rs1438068652 1524 dbSNP
rs567049924 1541 dbSNP
rs1204012656 1542 dbSNP
rs1231957376 1544 dbSNP
rs1480476080 1546 dbSNP
rs906720667 1548 dbSNP
rs1387587926 1552 dbSNP
rs1254143308 1561 dbSNP
rs1445733521 1562 dbSNP
rs538526097 1568 dbSNP
rs896724007 1574 dbSNP
rs1046558180 1576 dbSNP
rs1329712043 1577 dbSNP
rs1354178891 1587 dbSNP
rs1439691118 1588 dbSNP
rs1338498922 1592 dbSNP
rs1383313694 1605 dbSNP
rs940312807 1608 dbSNP
rs940833643 1619 dbSNP
rs908763313 1620 dbSNP
rs887563545 1621 dbSNP
rs1237870841 1627 dbSNP
rs983079521 1628 dbSNP
rs1205220157 1636 dbSNP
rs1245330951 1642 dbSNP
rs1183515814 1645 dbSNP
rs34390288 1645 dbSNP
rs1308551724 1646 dbSNP
rs573106037 1654 dbSNP
rs930286475 1657 dbSNP
rs553050231 1661 dbSNP
rs536248586 1663 dbSNP
rs920368115 1667 dbSNP
rs931648225 1675 dbSNP
rs1464238956 1679 dbSNP
rs1178918136 1685 dbSNP
rs764089904 1687 dbSNP
rs147918373 1688 dbSNP
rs1332040006 1692 dbSNP
rs976422508 1694 dbSNP
rs944649326 1698 dbSNP
rs547016737 1699 dbSNP
rs1363877126 1700 dbSNP
rs964474155 1705 dbSNP
rs748632557 1713 dbSNP
rs372842740 1714 dbSNP
rs913137026 1716 dbSNP
rs1449263290 1732 dbSNP
rs1019232892 1738 dbSNP
rs1441630086 1745 dbSNP
rs987293473 1748 dbSNP
rs1254071049 1751 dbSNP
rs966620998 1752 dbSNP
rs1206838558 1761 dbSNP
rs111626666 1765 dbSNP
rs1430258309 1766 dbSNP
rs1020861016 1767 dbSNP
rs572967039 1768 dbSNP
rs771374028 1772 dbSNP
rs1032842670 1775 dbSNP
rs537183856 1779 dbSNP
rs571726416 1780 dbSNP
rs1317624946 1781 dbSNP
rs866527061 1789 dbSNP
rs1361912138 1799 dbSNP
rs1358069055 1804 dbSNP
rs1033670474 1805 dbSNP
rs551973588 1809 dbSNP
rs1344499565 1811 dbSNP
rs193254270 1817 dbSNP
rs1232939439 1818 dbSNP
rs1273416748 1821 dbSNP
rs1339088531 1826 dbSNP
rs1353357542 1830 dbSNP
rs1320611849 1832 dbSNP
rs1206229473 1841 dbSNP
rs969814434 1842 dbSNP
rs1023662702 1845 dbSNP
rs188751457 1864 dbSNP
rs1013580342 1876 dbSNP
rs1480212617 1879 dbSNP
rs143348361 1880 dbSNP
rs758482043 1894 dbSNP
rs1365310639 1896 dbSNP
rs752615152 1902 dbSNP
rs887376922 1906 dbSNP
rs1048596572 1914 dbSNP
rs1015182406 1916 dbSNP
rs1358564847 1918 dbSNP
rs1425954423 1918 dbSNP
rs1303265911 1923 dbSNP
rs1163815790 1927 dbSNP
rs765152315 1932 dbSNP
rs931568629 1939 dbSNP
rs1330546391 1940 dbSNP
rs1366501176 1955 dbSNP
rs1195013461 1956 dbSNP
rs1309103545 1958 dbSNP
rs887918095 1960 dbSNP
rs1248848488 1963 dbSNP
rs1292556733 1967 dbSNP
rs529713198 1970 dbSNP
rs1038693829 1971 dbSNP
rs149201864 1975 dbSNP
rs943145785 1979 dbSNP
rs911607525 1980 dbSNP
rs1180852571 1981 dbSNP
rs1378361949 1982 dbSNP
rs931726108 1984 dbSNP
rs987321301 1985 dbSNP
rs1490856781 1987 dbSNP
rs544299004 1991 dbSNP
rs530641430 1995 dbSNP
rs112687529 1998 dbSNP
rs1389530505 1998 dbSNP
rs762713394 2001 dbSNP
rs1426566132 2002 dbSNP
rs1188503100 2005 dbSNP
rs1447975505 2015 dbSNP
rs1250326748 2016 dbSNP
rs1384065755 2019 dbSNP
rs1189403421 2021 dbSNP
rs564894185 2026 dbSNP
rs1235779918 2027 dbSNP
rs1169224368 2036 dbSNP
rs900231969 2041 dbSNP
rs1468225547 2044 dbSNP
rs1392287813 2046 dbSNP
rs8392 2047 dbSNP
rs1280881535 2054 dbSNP
rs1227576613 2055 dbSNP
rs769654835 2057 dbSNP
rs1299570459 2060 dbSNP
rs1455038718 2062 dbSNP
rs944368233 2066 dbSNP
rs1378043002 2067 dbSNP
rs1259197422 2072 dbSNP
rs1300561995 2074 dbSNP
rs1253243541 2075 dbSNP
rs1449512650 2076 dbSNP
rs1187951436 2079 dbSNP
rs1198299009 2080 dbSNP
rs1375526444 2081 dbSNP
rs755407950 2082 dbSNP
rs6041749 2084 dbSNP
rs1392394986 2091 dbSNP
rs1171613169 2092 dbSNP
rs1242463543 2093 dbSNP
rs773117898 2098 dbSNP
rs1411973906 2099 dbSNP
rs1183826761 2101 dbSNP
rs1052927128 2102 dbSNP
rs935838301 2104 dbSNP
rs375283376 2106 dbSNP
rs772224870 2107 dbSNP
rs1482060322 2110 dbSNP
rs1276474108 2111 dbSNP
rs1337897400 2114 dbSNP
rs1471163358 2114 dbSNP
rs980327524 2115 dbSNP
rs1320729143 2116 dbSNP
rs1310054649 2119 dbSNP
rs1297775159 2120 dbSNP
rs553228856 2122 dbSNP
rs550532523 2124 dbSNP
rs1306929453 2128 dbSNP
rs755260902 2134 dbSNP
rs1256480911 2138 dbSNP
rs916646224 2141 dbSNP
rs1204079017 2142 dbSNP
rs1255296080 2155 dbSNP
rs1422899920 2159 dbSNP
rs1191432672 2172 dbSNP
rs992201376 2173 dbSNP
rs1261795152 2179 dbSNP
rs960658819 2180 dbSNP
rs145404495 2182 dbSNP
rs530800255 2182 dbSNP
rs1481594611 2187 dbSNP
rs1027846356 2192 dbSNP
rs756496309 2192 dbSNP
rs73581254 2193 dbSNP
rs1291206264 2194 dbSNP
rs776938605 2202 dbSNP
rs1275345816 2204 dbSNP
rs1196813428 2205 dbSNP
rs900283691 2207 dbSNP
rs752454371 2208 dbSNP
rs1300303227 2211 dbSNP
rs1256497160 2214 dbSNP
rs1040097127 2217 dbSNP
rs564998081 2224 dbSNP
rs1346652334 2227 dbSNP
rs537120656 2229 dbSNP
rs11712 2248 dbSNP
rs1435086993 2250 dbSNP
rs1329062398 2252 dbSNP
rs1330457373 2261 dbSNP
rs1190320929 2266 dbSNP
rs1052976810 2272 dbSNP
rs11550413 2275 dbSNP
rs1161832687 2286 dbSNP
rs1364897048 2290 dbSNP
rs529373359 2292 dbSNP
rs1296382519 2294 dbSNP
rs935958291 2297 dbSNP
rs1405763595 2300 dbSNP
rs558030239 2304 dbSNP
rs760809823 2313 dbSNP
rs1470926458 2314 dbSNP
rs573002082 2315 dbSNP
rs1172110894 2322 dbSNP
rs916670187 2323 dbSNP
rs1477081608 2327 dbSNP
rs1234875186 2328 dbSNP
rs1490387796 2330 dbSNP
rs1220373484 2332 dbSNP
rs1244629349 2334 dbSNP
rs773496036 2343 dbSNP
rs1179346765 2349 dbSNP
rs960709715 2351 dbSNP
rs183005812 2356 dbSNP
rs1157439463 2363 dbSNP
rs1387156350 2369 dbSNP
rs770618418 2379 dbSNP
rs397795937 2380 dbSNP
rs983838887 2380 dbSNP
rs566192347 2381 dbSNP
rs559491604 2382 dbSNP
rs1240647312 2383 dbSNP
rs529651885 2384 dbSNP
rs1278531291 2385 dbSNP
rs1018655649 2386 dbSNP
rs1308928924 2386 dbSNP
rs1008569706 2387 dbSNP
rs1280717298 2388 dbSNP
rs1245525023 2389 dbSNP
rs34401063 2390 dbSNP
rs756346750 2390 dbSNP
rs758498752 2390 dbSNP
rs879138498 2390 dbSNP
rs891478235 2390 dbSNP
rs77001193 2392 dbSNP
rs1052750099 2393 dbSNP
rs1463873569 2396 dbSNP
rs1338563749 2402 dbSNP
rs1375628824 2405 dbSNP
rs1000263220 2411 dbSNP
rs376131801 2411 dbSNP
rs575859500 2412 dbSNP
rs1363525530 2413 dbSNP
rs146670225 2414 dbSNP
rs1317613404 2422 dbSNP
rs948589309 2423 dbSNP
rs45473597 2424 dbSNP
rs895623307 2427 dbSNP
rs1443465773 2428 dbSNP
rs1210091172 2431 dbSNP
rs1056580937 2438 dbSNP
rs939441093 2441 dbSNP
rs1333417666 2443 dbSNP
rs1476470534 2444 dbSNP
rs1194575964 2445 dbSNP
rs1423199509 2447 dbSNP
rs45553532 2456 dbSNP
rs1412630427 2460 dbSNP
rs907945653 2462 dbSNP
rs550608954 2463 dbSNP
rs530480273 2464 dbSNP
rs190714238 2470 dbSNP
rs1346385271 2472 dbSNP
rs187106305 2474 dbSNP
rs1277124538 2475 dbSNP
rs369976663 2481 dbSNP
rs1378676132 2482 dbSNP
rs1185881613 2483 dbSNP
rs559156579 2491 dbSNP
rs1346223535 2493 dbSNP
rs1219154771 2494 dbSNP
rs542491861 2501 dbSNP
rs1483775402 2510 dbSNP
rs1448753937 2512 dbSNP
rs1217469515 2513 dbSNP
rs1262698572 2514 dbSNP
rs1019045637 2519 dbSNP
rs1487415653 2526 dbSNP
rs116729337 2527 dbSNP
rs955824951 2536 dbSNP
rs1441142647 2541 dbSNP
rs1449195702 2570 dbSNP
rs1170680104 2578 dbSNP
rs1477574810 2578 dbSNP
rs1410095606 2579 dbSNP
rs1031382497 2581 dbSNP
rs999869931 2582 dbSNP
rs904153091 2586 dbSNP
rs1406379786 2587 dbSNP
rs1323881646 2588 dbSNP
rs1344414829 2602 dbSNP
rs1233002976 2606 dbSNP
rs917790935 2610 dbSNP
rs991990932 2615 dbSNP
rs1306627466 2622 dbSNP
rs1285376442 2623 dbSNP
rs1351680599 2627 dbSNP
rs1224914166 2628 dbSNP
rs1450771175 2629 dbSNP
rs1803585 2633 dbSNP
rs116279343 2646 dbSNP
rs1158033961 2648 dbSNP
rs879207230 2654 dbSNP
rs1301978639 2661 dbSNP
rs1377943292 2664 dbSNP
rs578000764 2665 dbSNP
rs1445775446 2670 dbSNP
rs866378749 2672 dbSNP
rs1163421745 2675 dbSNP
rs1389597580 2677 dbSNP
rs895718244 2680 dbSNP
rs1321956679 2689 dbSNP
rs1379644523 2693 dbSNP
rs1448156884 2697 dbSNP
rs1057017409 2699 dbSNP
rs1346846351 2707 dbSNP
rs1298936662 2708 dbSNP
rs1266216999 2712 dbSNP
rs1355866925 2717 dbSNP
rs1274841667 2718 dbSNP
rs939826179 2720 dbSNP
rs748541864 2721 dbSNP
rs886562360 2722 dbSNP
rs1048236027 2723 dbSNP
rs930666919 2724 dbSNP
rs1413560545 2725 dbSNP
rs920560246 2726 dbSNP
rs79119937 2730 dbSNP
rs1313501285 2731 dbSNP
rs1456046502 2731 dbSNP
rs1491012395 2731 dbSNP
rs376816789 2731 dbSNP
rs547041142 2731 dbSNP
rs878978089 2731 dbSNP
rs1340006514 2734 dbSNP
rs1321933997 2738 dbSNP
rs1180427146 2748 dbSNP
rs879249241 2750 dbSNP
rs558231173 2754 dbSNP
rs542591675 2761 dbSNP
rs1280342375 2772 dbSNP
rs1318261182 2776 dbSNP
rs573858832 2780 dbSNP
rs1256036590 2788 dbSNP
rs1484178296 2796 dbSNP
rs1216792508 2797 dbSNP
rs1201018876 2815 dbSNP
rs1254857960 2823 dbSNP
rs943645675 2827 dbSNP
rs534848822 2833 dbSNP
rs912140375 2843 dbSNP
rs750597546 2861 dbSNP
rs956171550 2861 dbSNP
rs1031429403 2864 dbSNP
rs1468017137 2871 dbSNP
rs1304000423 2883 dbSNP
rs978890044 2886 dbSNP
rs6109642 2892 dbSNP
rs968431593 2898 dbSNP
rs1300223368 2904 dbSNP
rs1341397318 2905 dbSNP
rs6134735 2909 dbSNP
rs1218297601 2916 dbSNP
rs761469042 2922 dbSNP
rs1313800997 2927 dbSNP
rs1012576728 2928 dbSNP
rs1255350103 2931 dbSNP
rs895769299 2935 dbSNP
rs1226379197 2938 dbSNP
rs1263320158 2953 dbSNP
rs572575457 2953 dbSNP
rs1487743979 2957 dbSNP
rs1364041023 2964 dbSNP
rs1278748942 2980 dbSNP
rs1177354849 2984 dbSNP
rs1035602080 2986 dbSNP
rs1377580425 2986 dbSNP
rs1300083546 2987 dbSNP
rs1004051018 2988 dbSNP
rs886905685 2995 dbSNP
rs1304990125 2996 dbSNP
rs6109641 2999 dbSNP
rs1047819514 3001 dbSNP
rs776032411 3012 dbSNP
rs1296660006 3020 dbSNP
rs6109639 3027 dbSNP
rs1369383146 3035 dbSNP
rs1387154569 3045 dbSNP
rs1458621211 3051 dbSNP
rs1349490015 3052 dbSNP
rs1163167464 3058 dbSNP
rs1803586 3061 dbSNP
rs6109638 3063 dbSNP
rs899228494 3067 dbSNP
rs1039472485 3071 dbSNP
rs1062369 3074 dbSNP
rs943372503 3081 dbSNP
rs1489658274 3084 dbSNP
rs912151666 3086 dbSNP
rs1453063421 3089 dbSNP
rs112758107 3107 dbSNP
rs536131247 3114 dbSNP
rs1477092359 3115 dbSNP
rs1051933242 3123 dbSNP
rs1260455646 3124 dbSNP
rs112780650 3127 dbSNP
rs1157063901 3132 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL35
Disease MIMAT0022717
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020022. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020022
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL35 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000400137.4 | 3UTR | UCAAGUUUUAUUAUUGCAAUAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000400137.4 | 3UTR | UCAAGUUUUAUUAUUGCAAUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000400137.4 | 3UTR | UCAAGUUUUAUUAUUGCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081178 MIDN midnolin 2 4
MIRT109809 ZFX zinc finger protein, X-linked 2 4
MIRT242383 TMC5 transmembrane channel like 5 2 4
MIRT444003 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444097 SEPHS1 selenophosphate synthetase 1 2 2
MIRT446158 RPL12 ribosomal protein L12 2 2
MIRT446859 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT447275 FZD5 frizzled class receptor 5 2 2
MIRT447391 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT448817 FKBP1A FK506 binding protein 1A 2 4
MIRT450582 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT451776 USP36 ubiquitin specific peptidase 36 2 2
MIRT457961 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT458424 KLHL38 kelch like family member 38 2 4
MIRT461383 SLFN12L schlafen family member 12 like 2 2
MIRT467793 SLC2A14 solute carrier family 2 member 14 2 2
MIRT476517 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT480290 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT482745 HES7 hes family bHLH transcription factor 7 2 10
MIRT483189 HIST1H2AH histone cluster 1 H2A family member h 2 6
MIRT486545 DCTN4 dynactin subunit 4 2 2
MIRT486581 ZNF619 zinc finger protein 619 2 2
MIRT492604 POLR3E RNA polymerase III subunit E 2 2
MIRT494130 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT496023 ZBED3 zinc finger BED-type containing 3 2 2
MIRT497121 NBEAL1 neurobeachin like 1 2 2
MIRT497400 TMEM245 transmembrane protein 245 2 2
MIRT501410 RANBP10 RAN binding protein 10 2 2
MIRT510947 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT512494 ARID2 AT-rich interaction domain 2 2 2
MIRT512595 ZNF783 zinc finger family member 783 2 2
MIRT512612 CNTN4 contactin 4 2 2
MIRT517808 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT520686 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT526179 HEPH hephaestin 2 2
MIRT532568 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT533979 TADA2A transcriptional adaptor 2A 2 2
MIRT538622 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539703 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539806 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT540422 FAM83F family with sequence similarity 83 member F 2 2
MIRT540506 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540619 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT542423 ZNF331 zinc finger protein 331 2 2
MIRT542454 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT543383 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT544777 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT544923 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 2
MIRT549768 ZNF611 zinc finger protein 611 2 4
MIRT551242 COLEC10 collectin subfamily member 10 2 2
MIRT560474 ENSA endosulfine alpha 2 2
MIRT569738 GPR173 G protein-coupled receptor 173 2 2
MIRT571297 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT572345 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT573112 ERBB2IP erbb2 interacting protein 2 2
MIRT607744 ANGPT4 angiopoietin 4 2 2
MIRT607903 SPRYD4 SPRY domain containing 4 2 2
MIRT611744 SERPING1 serpin family G member 1 2 4
MIRT615101 BNC2 basonuclin 2 2 2
MIRT619124 CD40LG CD40 ligand 2 2
MIRT625572 ANKRD42 ankyrin repeat domain 42 2 2
MIRT629038 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633986 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635675 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637471 DEFB105B defensin beta 105B 2 4
MIRT637503 DEFB105A defensin beta 105A 2 4
MIRT639735 MAP2K2 mitogen-activated protein kinase kinase 2 2 2
MIRT640730 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645364 C9orf47 chromosome 9 open reading frame 47 2 2
MIRT647938 RNF152 ring finger protein 152 2 2
MIRT649400 SH2D4A SH2 domain containing 4A 2 2
MIRT656860 KIN Kin17 DNA and RNA binding protein 2 2
MIRT663470 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663507 NKAPL NFKB activating protein like 2 4
MIRT667690 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT677403 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT678682 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT678789 NUPL2 nucleoporin like 2 2 2
MIRT680649 KIAA1456 KIAA1456 2 2
MIRT682450 MTX3 metaxin 3 2 2
MIRT682740 CA6 carbonic anhydrase 6 2 2
MIRT684421 TUFT1 tuftelin 1 2 2
MIRT690535 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT690595 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690771 PLA2G2C phospholipase A2 group IIC 2 2
MIRT692233 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693667 MXRA7 matrix remodeling associated 7 2 2
MIRT695551 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695870 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT696214 LYZ lysozyme 2 2
MIRT698368 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT700795 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT701640 MYLK3 myosin light chain kinase 3 2 2
MIRT702989 HERPUD2 HERPUD family member 2 2 2
MIRT703627 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT703783 FAM102B family with sequence similarity 102 member B 2 2
MIRT704293 DDX19B DEAD-box helicase 19B 2 2
MIRT704828 CDC73 cell division cycle 73 2 2
MIRT705014 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT708480 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710770 PHF7 PHD finger protein 7 2 2
MIRT718918 TRIM66 tripartite motif containing 66 2 2
MIRT720390 ZNF549 zinc finger protein 549 2 2
MIRT720593 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT723515 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724458 PRKX protein kinase, X-linked 2 2
MIRT737267 UMAD1 UBAP1-MVB12-associated (UMA) domain containing 1 3 0
MIRT737356 ZIC2 Zic family member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-873 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-873 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-873 Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-873 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-873-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-873-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission