miRTarBase - #MIRT449088


—
pre-miRNA Information
pre-miRNA hsa-mir-3180-1   
Genomic Coordinates chr16: 14911220 - 14911313
Description Homo sapiens miR-3180-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-2   
Genomic Coordinates chr16: 16309879 - 16309966
Description Homo sapiens miR-3180-2 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-3   
Genomic Coordinates chr16: 18402178 - 18402271
Description Homo sapiens miR-3180-3 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3180-3p
Sequence 62| UGGGGCGGAGCUUCCGGAGGCC |83
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol XPO6   
Synonyms EXP6, RANBP20
Description exportin 6
Transcript NM_015171   
Expression
Putative miRNA Targets on XPO6
3'UTR of XPO6
(miRNA target sites are highlighted)		 
>XPO6|NM_015171|3'UTR
   1 GCCTGCTACTGCCTGGGGACACGGACTTCTGCTGCTGCCACCTGCGCCAGCCCTACCTTCCACCACAGATGTCTCCCAGA
  81 TGGGCCTTGGTCACACTCCTTGGCTTCTCCCACCGCAAGCAACGCTGCCTGCCTCTGCCGCTCCTCCACATCTTGCCGCT
 161 GCCCAGCAGAGCTGGCTTCTGGGTCCACCTGAGCACTGGACGGTGCTCCCAGGGCGTTGGAGCAGGCGGAGGGGTGTGTG
 241 GCCAGGTACTAGGAGGCACCAGGAAATCCCGCGGGGTGGCCCATGCAGACCAGGCGCACGTGGCTCATGGGGCAGAATTG
 321 CCAAGGACAGCTCACGACAGTGCCACCTTCTCACCATTCCAGCCAAGGAGAGATGTGACGTTGGAACTGCTCTGGCACTT
 401 CTGTCAAGCCTCCCCCGCCCCAATTGCCTTGAGATCTCTGCTCTTTGTCAGAGATTTGCAAAGACTCACGTTTTTGTTGT
 481 TTTCTCATCATTCCATTGTGATACTAAGAAACTAAGAAGCTTAATGAAAAGAAATAAAATGCCTATGTTGTTGTTCTAGA
 561 AAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccGGAGGC-CUUC-GA---GGCGGGGu 5'
            |:||:|  ||| ||   ||||||| 
Target 5' caCTTCTGTCAAGCCTCCCCCGCCCCa 3'
 396 - 422 156.00 -26.40
2 
miRNA  3' ccGGAGGCCUUCGA-GGCGGGGu 5'
            |: || |   || ||||:|| 
Target 5' cgCTGCCTGCCTCTGCCGCTCCt 3'
 123 - 145 132.00 -21.80
3 
miRNA  3' ccGGAGGCCUUCGAGGCGGGGu 5'
            ||| :| :| |||:||:|: 
Target 5' tgCCT-TGAGATCTCTGCTCTt 3'
 425 - 445 115.00 -18.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30456049 3 COSMIC
COSN31608481 23 COSMIC
COSN30501325 46 COSMIC
COSN31507607 60 COSMIC
COSN26603582 420 COSMIC
COSN17037339 463 COSMIC
COSN5406276 471 COSMIC
COSN28690592 486 COSMIC
COSN1696850 495 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1199255626 1 dbSNP
rs775773051 2 dbSNP
rs1265053004 4 dbSNP
rs772624875 5 dbSNP
rs746413554 6 dbSNP
rs1459620605 8 dbSNP
rs369506766 13 dbSNP
rs779589410 17 dbSNP
rs1238066901 18 dbSNP
rs1199692886 19 dbSNP
rs771098924 19 dbSNP
rs1448674169 20 dbSNP
rs749386636 22 dbSNP
rs777997338 23 dbSNP
rs756349713 24 dbSNP
rs1329676363 37 dbSNP
rs1298270611 38 dbSNP
rs376854514 39 dbSNP
rs764519581 39 dbSNP
rs779754259 40 dbSNP
rs758309904 41 dbSNP
rs750310920 44 dbSNP
rs765189070 45 dbSNP
rs761244389 46 dbSNP
rs1446976116 52 dbSNP
rs576057709 55 dbSNP
rs1402034976 56 dbSNP
rs956287847 75 dbSNP
rs1359395686 94 dbSNP
rs1032653998 96 dbSNP
rs28574753 99 dbSNP
rs983297928 105 dbSNP
rs1232184461 111 dbSNP
rs8049992 114 dbSNP
rs1177502922 115 dbSNP
rs1017345234 123 dbSNP
rs1434978851 124 dbSNP
rs1490523090 137 dbSNP
rs1224826360 138 dbSNP
rs1030232189 139 dbSNP
rs1182981079 140 dbSNP
rs1234997476 144 dbSNP
rs1009100021 150 dbSNP
rs890263489 156 dbSNP
rs761077450 157 dbSNP
rs1424668489 165 dbSNP
rs1048037904 175 dbSNP
rs964637215 176 dbSNP
rs1388115374 181 dbSNP
rs1385936782 182 dbSNP
rs145100110 183 dbSNP
rs1458347636 186 dbSNP
rs1240295447 190 dbSNP
rs899070482 199 dbSNP
rs1037612203 201 dbSNP
rs1256501449 202 dbSNP
rs1263830868 209 dbSNP
rs941358551 214 dbSNP
rs1042563618 215 dbSNP
rs554158279 216 dbSNP
rs1178413654 217 dbSNP
rs1244225492 220 dbSNP
rs927326074 227 dbSNP
rs112922809 228 dbSNP
rs1366256530 232 dbSNP
rs1044447762 233 dbSNP
rs950185756 234 dbSNP
rs1056650024 237 dbSNP
rs552640230 240 dbSNP
rs938233916 241 dbSNP
rs1330497632 242 dbSNP
rs989402827 244 dbSNP
rs956214764 248 dbSNP
rs1378599332 250 dbSNP
rs926178803 263 dbSNP
rs979040290 271 dbSNP
rs763758094 272 dbSNP
rs762553918 273 dbSNP
rs1253221087 274 dbSNP
rs1316309282 276 dbSNP
rs1198393716 279 dbSNP
rs1017688547 281 dbSNP
rs1390021863 286 dbSNP
rs1463022286 289 dbSNP
rs983298093 295 dbSNP
rs1256108629 296 dbSNP
rs779796867 299 dbSNP
rs955504321 300 dbSNP
rs1374196312 301 dbSNP
rs923068656 304 dbSNP
rs1476675758 307 dbSNP
rs1169661601 308 dbSNP
rs1440441584 312 dbSNP
rs1008621403 314 dbSNP
rs1179999554 321 dbSNP
rs1418278390 333 dbSNP
rs1256509720 335 dbSNP
rs775080031 336 dbSNP
rs11291 344 dbSNP
rs149945113 354 dbSNP
rs964585300 356 dbSNP
rs551753369 362 dbSNP
rs1026088736 379 dbSNP
rs993279000 380 dbSNP
rs8049141 403 dbSNP
rs968145756 407 dbSNP
rs1020683735 412 dbSNP
rs1277407661 414 dbSNP
rs79537335 416 dbSNP
rs745842576 417 dbSNP
rs189775795 419 dbSNP
rs1313822200 421 dbSNP
rs35639093 422 dbSNP
rs776690413 423 dbSNP
rs1374144243 430 dbSNP
rs1264757650 434 dbSNP
rs905830295 444 dbSNP
rs1192414472 445 dbSNP
rs566589661 447 dbSNP
rs1434618410 454 dbSNP
rs905448413 459 dbSNP
rs139764280 469 dbSNP
rs746783879 470 dbSNP
rs1453249377 476 dbSNP
rs376364780 479 dbSNP
rs941348714 482 dbSNP
rs1358755236 483 dbSNP
rs1369289181 490 dbSNP
rs1303917571 492 dbSNP
rs1399511945 492 dbSNP
rs1189308378 494 dbSNP
rs887086725 499 dbSNP
rs1474123825 511 dbSNP
rs1047073071 520 dbSNP
rs1241874722 521 dbSNP
rs1284537454 526 dbSNP
rs950139076 535 dbSNP
rs185022379 537 dbSNP
rs551502992 542 dbSNP
rs1053221952 543 dbSNP
rs1489290139 544 dbSNP
rs934806679 545 dbSNP
rs1266457842 547 dbSNP
rs1419577880 553 dbSNP
rs1160343245 556 dbSNP
rs1414797068 556 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccggaggccUUCGAGGCGGGGu 5'
                   |||  || |||| 
Target 5' -------ucAAG--CCUCCCCc 3'
 		1 - 13
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000565698.1 | 3UTR | UCAAGCCUCCCCCGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
66 hsa-miR-3180-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT133792 SKI SKI proto-oncogene 2 2
MIRT146658 MINK1 misshapen like kinase 1 2 4
MIRT441337 C19orf26 CACN beta subunit associated regulatory protein 2 4
MIRT449088 XPO6 exportin 6 2 2
MIRT464967 TULP1 tubby like protein 1 2 6
MIRT471706 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT473252 MIDN midnolin 2 2
MIRT483494 STMN3 stathmin 3 2 4
MIRT483726 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT485684 CCDC64 BICD family like cargo adaptor 1 2 4
MIRT486046 WSCD1 WSC domain containing 1 2 4
MIRT486522 CLCN7 chloride voltage-gated channel 7 2 2
MIRT486779 SESTD1 SEC14 and spectrin domain containing 1 2 4
MIRT486852 DPF1 double PHD fingers 1 2 2
MIRT487035 C10orf55 chromosome 10 open reading frame 55 2 2
MIRT487082 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT487284 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 4
MIRT487992 RXRB retinoid X receptor beta 2 2
MIRT488101 POU3F1 POU class 3 homeobox 1 2 2
MIRT488547 POU3F3 POU class 3 homeobox 3 2 8
MIRT488582 ST7L suppression of tumorigenicity 7 like 2 2
MIRT488757 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489217 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489350 SYNGR1 synaptogyrin 1 2 4
MIRT489385 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT489459 MSC musculin 2 2
MIRT489469 SLITRK5 SLIT and NTRK like family member 5 2 2
MIRT489749 TACC3 transforming acidic coiled-coil containing protein 3 2 2
MIRT490244 MFI2 melanotransferrin 2 2
MIRT490423 VPS51 VPS51, GARP complex subunit 2 4
MIRT490644 FEM1A fem-1 homolog A 2 2
MIRT491977 UNK unkempt family zinc finger 2 2
MIRT492469 RASD1 ras related dexamethasone induced 1 2 4
MIRT492837 NRGN neurogranin 2 2
MIRT492956 NEUROD2 neuronal differentiation 2 2 2
MIRT493002 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT493430 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT493709 H2AFX H2A histone family member X 2 6
MIRT493886 FAM43A family with sequence similarity 43 member A 2 4
MIRT493955 ENG endoglin 2 2
MIRT500168 MSI1 musashi RNA binding protein 1 2 2
MIRT500196 MAPK8IP3 mitogen-activated protein kinase 8 interacting protein 3 2 4
MIRT500366 ZNF385A zinc finger protein 385A 2 2
MIRT501159 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501698 PCGF3 polycomb group ring finger 3 2 6
MIRT512173 CASP16 caspase 16, pseudogene 2 6
MIRT512237 ATG2A autophagy related 2A 2 6
MIRT512879 PITX3 paired like homeodomain 3 2 2
MIRT531184 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT548362 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 4
MIRT569093 FSCN1 fascin actin-bundling protein 1 2 2
MIRT574133 MARVELD1 MARVEL domain containing 1 2 2
MIRT635542 LEPROTL1 leptin receptor overlapping transcript like 1 2 2
MIRT654098 RSBN1L round spermatid basic protein 1 like 2 2
MIRT664919 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT669843 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT670502 LYRM4 LYR motif containing 4 2 2
MIRT670526 SLC9A7 solute carrier family 9 member A7 2 2
MIRT670550 SHISA2 shisa family member 2 2 2
MIRT671031 PCDHB2 protocadherin beta 2 2 2
MIRT695219 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT700129 RNF144B ring finger protein 144B 2 2
MIRT709280 MAPK8IP2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT712750 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT720753 FAM193A family with sequence similarity 193 member A 2 2
MIRT724920 VPS18 VPS18, CORVET/HOPS core subunit 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3180 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3180 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-3180 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant Low Gastric Cancer cell line (MGC-803)
hsa-miR-3180-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3180-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-3180-3p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission