miRTarBase - #MIRT449468


—
pre-miRNA Information
pre-miRNA hsa-let-7a-1   
Genomic Coordinates chr9: 94175957 - 94176036
Synonyms LET7A1, MIRNLET7A1, let-7a-1, MIRLET7A1
Description Homo sapiens let-7a-1 stem-loop
Comment let-7a-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-let-7a-3   
Genomic Coordinates chr22: 46112749 - 46112822
Synonyms LET7A3, MIRNLET7A3, let-7a-3, MIRLET7A3
Description Homo sapiens let-7a-3 stem-loop
Comment let-7a-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7a-3p
Sequence 57| CUAUACAAUCUACUGUCUUUC |77
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 9 + 94176017 29233923 MiREDiBase
A-to-I 5 22 + 46112804 29233923 MiREDiBase
A-to-I 12 22 + 46112811 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs972845958 1 dbSNP
rs781681931 2 dbSNP
rs748585376 3 dbSNP
rs779353569 6 dbSNP
rs1198423693 8 dbSNP
rs970921980 8 dbSNP
rs372596018 9 dbSNP
rs770208205 10 dbSNP
rs1453867589 11 dbSNP
rs1399588338 15 dbSNP
rs1219969167 16 dbSNP
rs1265084977 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HAT1   
Synonyms KAT1
Description histone acetyltransferase 1
Transcript NM_003642   
Expression
Putative miRNA Targets on HAT1
3'UTR of HAT1
(miRNA target sites are highlighted)		 
>HAT1|NM_003642|3'UTR
   1 AGATTATACTGCTCTGTACAGGAAGCTTGCAAATTTTCTGTACAATGTGCTGTGAAAAATCTGATGACTTTAATTTTAAA
  81 ATCTTGTGACATTTTGCTTATACTAAAAGTTATCTATCTTTAGTTGAATATTTTCTTTTGGAGAGATTGTATATTTTAAA
 161 ATACTGTTTAGAGTTTATGAGCATATATTGCATTTAAAGAAAGATAAAGCTTCTGAAATACTACTGCAATTGCTTCCCTT
 241 CTTAAACAGTATAATAAATGCTTAGTTGTGATATGTTAATGTGTGATGATATGATTCTTAAATACTTACAATAAACCTCA
 321 TTCTTAAATACTTAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuuucugUCAUCUAACAUAUc 5'
                 || |||||||||| 
Target 5' cttttggAG-AGATTGTATAt 3'
 135 - 154 157.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31589436 51 COSMIC
COSN31595468 114 COSMIC
COSN30120762 136 COSMIC
COSN16366162 186 COSMIC
COSN5863910 250 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761354281 2 dbSNP
rs765097202 9 dbSNP
rs1399954193 10 dbSNP
rs373136761 11 dbSNP
rs374125888 13 dbSNP
rs192123385 15 dbSNP
rs766252846 16 dbSNP
rs1215695356 21 dbSNP
rs751332502 26 dbSNP
rs778205916 28 dbSNP
rs1278693624 30 dbSNP
rs924068607 55 dbSNP
rs1220640736 72 dbSNP
rs1272269458 73 dbSNP
rs1325210167 81 dbSNP
rs368733796 91 dbSNP
rs541124995 101 dbSNP
rs1367011655 103 dbSNP
rs958048313 114 dbSNP
rs1483975350 121 dbSNP
rs1205866479 122 dbSNP
rs1252608508 124 dbSNP
rs990003746 125 dbSNP
rs911305393 128 dbSNP
rs901547943 129 dbSNP
rs1189625004 131 dbSNP
rs1427555045 140 dbSNP
rs942747094 144 dbSNP
rs1451790015 147 dbSNP
rs1246553918 148 dbSNP
rs1186498830 152 dbSNP
rs1483849011 153 dbSNP
rs996225681 154 dbSNP
rs1211651285 155 dbSNP
rs1345046586 170 dbSNP
rs1279169485 176 dbSNP
rs1228677533 194 dbSNP
rs1050329798 206 dbSNP
rs1293136467 226 dbSNP
rs879850016 230 dbSNP
rs1379832077 232 dbSNP
rs559419625 234 dbSNP
rs564507241 238 dbSNP
rs1445915752 240 dbSNP
rs1168322588 248 dbSNP
rs922745212 258 dbSNP
rs1006070288 265 dbSNP
rs536744441 272 dbSNP
rs532941747 274 dbSNP
rs777385391 284 dbSNP
rs1388753388 285 dbSNP
rs930237133 289 dbSNP
rs1424712687 290 dbSNP
rs749707229 293 dbSNP
rs1014712958 294 dbSNP
rs1180556641 299 dbSNP
rs1309188502 310 dbSNP
rs544954702 312 dbSNP
rs771475464 332 dbSNP
rs1433720006 333 dbSNP
rs1205476838 334 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000392584.1 | 3UTR | UCAAGAUUUUUUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA 0.513 0.05 0.609 0.02 11 Click to see details
PAAD 0.889 0.06 0.800 0.1 4 Click to see details
KIRC -0.186 0.06 -0.225 0.03 68 Click to see details
PRAD -0.194 0.09 -0.185 0.1 50 Click to see details
KIRP -0.225 0.11 -0.021 0.45 32 Click to see details
BLCA 0.24 0.17 0.172 0.25 18 Click to see details
COAD -0.598 0.2 -0.800 0.1 4 Click to see details
UCEC 0.199 0.21 0.151 0.27 19 Click to see details
STAD 0.119 0.26 0.133 0.23 32 Click to see details
PCPG 0.651 0.27 0.500 0.33 3 Click to see details
KICH 0.12 0.28 0.048 0.41 25 Click to see details
CESC 0.511 0.33 0.500 0.33 3 Click to see details
THCA -0.057 0.33 -0.093 0.24 59 Click to see details
CHOL 0.109 0.39 -0.183 0.32 9 Click to see details
LIHC -0.035 0.41 -0.059 0.34 49 Click to see details
BRCA 0.022 0.42 -0.010 0.46 84 Click to see details
LUSC 0.022 0.45 0.085 0.31 38 Click to see details
HNSC -0.013 0.47 -0.060 0.35 42 Click to see details
LUAD 0.026 0.47 0.224 0.24 12 Click to see details
LUAD 0.026 0.47 0.224 0.24 12 Click to see details
121 hsa-let-7a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038998 ARMC8 armadillo repeat containing 8 1 1
MIRT038999 SETD4 SET domain containing 4 1 1
MIRT039000 BTF3 basic transcription factor 3 1 1
MIRT039001 MIPOL1 mirror-image polydactyly 1 1 1
MIRT039002 TRIM33 tripartite motif containing 33 1 1
MIRT039003 CS citrate synthase 1 1
MIRT039004 SENP7 SUMO1/sentrin specific peptidase 7 1 1
MIRT055418 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT057681 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT061351 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT062174 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT071813 RNF11 ring finger protein 11 2 2
MIRT091374 EIF4A2 eukaryotic translation initiation factor 4A2 2 2
MIRT095107 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT098814 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT109534 KLHL15 kelch like family member 15 2 4
MIRT120263 GSK3B glycogen synthase kinase 3 beta 2 2
MIRT149839 LDLR low density lipoprotein receptor 2 6
MIRT164519 MSMO1 methylsterol monooxygenase 1 2 2
MIRT165879 CREBRF CREB3 regulatory factor 2 2
MIRT169899 HBP1 HMG-box transcription factor 1 2 4
MIRT182779 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT193466 RORA RAR related orphan receptor A 2 2
MIRT226421 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT334410 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT338286 SYF2 SYF2 pre-mRNA splicing factor 2 2
MIRT361627 TES testin LIM domain protein 2 2
MIRT406687 ZNF181 zinc finger protein 181 2 2
MIRT407768 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT449468 HAT1 histone acetyltransferase 1 2 2
MIRT467110 SRI sorcin 2 2
MIRT475099 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 6
MIRT481671 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT493061 MTFR1 mitochondrial fission regulator 1 2 2
MIRT497923 BTG1 BTG anti-proliferation factor 1 2 2
MIRT498202 ACVR2B activin A receptor type 2B 2 2
MIRT503391 ASB11 ankyrin repeat and SOCS box containing 11 2 6
MIRT503862 UBXN2B UBX domain protein 2B 2 2
MIRT504368 ARID1B AT-rich interaction domain 1B 2 4
MIRT504991 ZNF652 zinc finger protein 652 2 2
MIRT505754 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT518102 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide 2 6
MIRT521930 PHF8 PHD finger protein 8 2 4
MIRT522139 NRBF2 nuclear receptor binding factor 2 2 6
MIRT522401 MYADM myeloid associated differentiation marker 2 4
MIRT523593 FZD5 frizzled class receptor 5 2 4
MIRT523944 E2F8 E2F transcription factor 8 2 4
MIRT524355 CREB1 cAMP responsive element binding protein 1 2 2
MIRT525140 ZNF256 zinc finger protein 256 2 2
MIRT527070 ABCC4 ATP binding cassette subfamily C member 4 2 2
MIRT527486 OCIAD1 OCIA domain containing 1 2 2
MIRT528129 PPP1R10 protein phosphatase 1 regulatory subunit 10 2 2
MIRT530528 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT531270 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT538898 BRI3BP BRI3 binding protein 2 2
MIRT541371 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT541526 MGAT4C MGAT4 family member C 2 2
MIRT543776 RBM12B RNA binding motif protein 12B 2 4
MIRT543946 NCOA7 nuclear receptor coactivator 7 2 2
MIRT545156 GABRG1 gamma-aminobutyric acid type A receptor gamma1 subunit 2 2
MIRT545848 ZNF264 zinc finger protein 264 2 4
MIRT546064 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT546481 SLC16A14 solute carrier family 16 member 14 2 4
MIRT551835 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT551901 ACP1 acid phosphatase 1, soluble 2 2
MIRT552490 ZNF136 zinc finger protein 136 2 2
MIRT554206 SLC35A5 solute carrier family 35 member A5 2 2
MIRT554295 SIPA1L2 signal induced proliferation associated 1 like 2 2 2
MIRT555765 PCTP phosphatidylcholine transfer protein 2 2
MIRT558315 DSG2 desmoglein 2 2 2
MIRT563147 NOLC1 nucleolar and coiled-body phosphoprotein 1 2 2
MIRT566464 PGGT1B protein geranylgeranyltransferase type I subunit beta 2 2
MIRT567322 HMGB2 high mobility group box 2 2 2
MIRT567738 DLX2 distal-less homeobox 2 2 2
MIRT567892 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT570087 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 2
MIRT571136 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT573534 MDM2 MDM2 proto-oncogene 2 2
MIRT574465 RPS16 ribosomal protein S16 2 2
MIRT574998 Phka1 phosphorylase kinase alpha 1 2 3
MIRT610202 CD99 CD99 molecule (Xg blood group) 2 4
MIRT612926 GPRIN3 GPRIN family member 3 2 2
MIRT615027 DUSP6 dual specificity phosphatase 6 2 2
MIRT617200 GREM1 gremlin 1, DAN family BMP antagonist 2 2
MIRT628720 ZNF585A zinc finger protein 585A 2 2
MIRT641491 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT641663 PAPOLG poly(A) polymerase gamma 2 2
MIRT642216 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT654589 PURA purine rich element binding protein A 2 2
MIRT656136 MSH6 mutS homolog 6 2 2
MIRT656899 KIAA2018 upstream transcription factor family member 3 2 2
MIRT660136 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT660861 AFAP1 actin filament associated protein 1 2 2
MIRT676849 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 3
MIRT681479 DIP2A disco interacting protein 2 homolog A 2 2
MIRT682259 RS1 retinoschisin 1 2 2
MIRT685602 MYOM2 myomesin 2 2 2
MIRT686943 SFT2D3 SFT2 domain containing 3 2 2
MIRT694302 COPB2 coatomer protein complex subunit beta 2 2 2
MIRT694407 ALDH1A3 aldehyde dehydrogenase 1 family member A3 2 2
MIRT697280 ZNF800 zinc finger protein 800 2 2
MIRT698414 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT698989 SPAG9 sperm associated antigen 9 2 2
MIRT699766 SEMA4D semaphorin 4D 2 2
MIRT699928 RUFY2 RUN and FYVE domain containing 2 2 2
MIRT702113 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT702373 KLF10 Kruppel like factor 10 2 2
MIRT702646 ITGA3 integrin subunit alpha 3 2 2
MIRT705713 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT717925 ZNF546 zinc finger protein 546 2 2
MIRT720839 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT725033 NDUFAF7 NADH:ubiquinone oxidoreductase complex assembly factor 7 2 2
MIRT731448 APOBEC3A apolipoprotein B mRNA editing enzyme catalytic subunit 3A 1 1
MIRT733217 CCNG1 cyclin G1 2 0
MIRT734887 LIN28B lin-28 homolog B 1 0
MIRT735276 HMGA2 high mobility group AT-hook 2 2 0
MIRT735727 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 3 0
MIRT736087 RCVRN recoverin 1 0
MIRT736088 RHO rhodopsin 1 0
MIRT736103 TLR7 toll like receptor 7 1 0
MIRT736607 TPO thyroid peroxidase 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7a Caudatin NULL 21633059 Quantitative real-time PCR gastric carcinoma cell lines 23708208 2013 up-regualted
let-7a XMD8-92 NULL 46843772 Microarray pancreatic ductal adenocarcinoma cell 24880079 2014 up-regulated
let-7a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7a Hydroxamic acid HDACi LAQ824 NULL NULL Northern blot breast cancer cell line SKBr3 16452180 2006 down-regulated
let-7a Trichostatin A (TSA) NULL 444732 Microarray human pancreatic cancer cell line BxPC-3 19112422 2009 down-regulated
let-7a 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7a Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
let-7a Etoposide approved 36462 Quantitative real-time PCR Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
let-7a Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
let-7a Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
let-7a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7a Enoxacin approved 3229 Northern blot HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
let-7a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
let-7a Metformin approved 4091 Quantitative real-time PCR MCF-7 human mammary cancer cell line 21368581 2011 up-regulated
let-7a 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
let-7a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
let-7a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
let-7a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
let-7a CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
let-7a Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7a Curcumin NULL 969516 Quantitative real-time PCR esophageal cancer cells 22363450 2012 up-regulated
let-7a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
let-7a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
let-7a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
let-7a Budesonide approved 5281004 Microarray neonatal mice lung 20145010 2010 down-regulated
let-7a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice lung 20145010 2010 up-regulated
let-7a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
let-7a Dexamethasone approved 5743 Quantitative real-time PCR primary rat thymocytes 20847043 2010 down-regulated
let-7a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
let-7a Hydroxychloroquine approved 3652 Quantitative real-time PCR mesangial cells 24121037 2013 down-regualted
let-7a Prednisone approved 5865 Quantitative real-time PCR mesangial cells 24121037 2013 down-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7a-3p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-let-7a-3p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-let-7a-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-let-7a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-let-7a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-let-7a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-let-7a-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-let-7a-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-let-7a-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-let-7a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7a-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-let-7a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission