miRTarBase - #MIRT449750


—
pre-miRNA Information
pre-miRNA hsa-mir-628   
Genomic Coordinates chr15: 55372940 - 55373034
Synonyms MIRN628, hsa-mir-628, MIR628
Description Homo sapiens miR-628 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-628-5p
Sequence 23| AUGCUGACAUAUUUACUAGAGG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN15665015 15 COSMIC
COSN30467735 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs761527552 8 dbSNP
rs776423775 9 dbSNP
rs200771662 11 dbSNP
rs760615166 12 dbSNP
rs747172385 13 dbSNP
rs775387693 16 dbSNP
rs771606673 19 dbSNP
rs745373506 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SMYD2   
Synonyms HSKM-B, KMT3C, ZMYND14
Description SET and MYND domain containing 2
Transcript NM_020197   
Expression
Putative miRNA Targets on SMYD2
3'UTR of SMYD2
(miRNA target sites are highlighted)		 
>SMYD2|NM_020197|3'UTR
   1 AACTATGCAGCATTTCAGTTTTCATTTAAACACTTAGTTCAGAAACCTTAAAGGATTTGAATATTTCAAATTGCACACGT
  81 CACTCCAGCATCTCTGTAAAATAATTGGAATGAAAATACTTCTTGCACTTAAACACTGCACATGCCGTACTTTGAGGTTA
 161 GTCTGAATCTTGAACTTTAATACCAAATTAATTTTGAATGCTTTTGTTTCCTAAGAGATAATGGCATGGTTTCATATGTT
 241 ATACTTTGGACAGACAGAGTTTTAAAAATGGAATTATTTTTTCTTTCATGCCTCTTGTAATGTTCTGAACAAACTTGAAT
 321 GATGAAAGTATTAAAGAGATATCAGTATTTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggagAUCAUU--UAUACAGUCGUa 5'
              || |||  | || ||||:| 
Target 5' aaagTATTAAAGAGATATCAGTAt 3'
 325 - 348 116.00 -6.90
2 
miRNA  3' ggagaucaUUUAUACAGUCGUa 5'
                  || |||| ||||| 
Target 5' --------AACTATG-CAGCAt 3'
 1 - 13 110.00 -7.80
3 
miRNA  3' ggagaucauuuauacaGUCGUa 5'
                          ||||| 
Target 5' attgcacacgtcactcCAGCAt 3'
 70 - 91 100.00 -5.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30537544 14 COSMIC
COSN30171191 16 COSMIC
COSN30514421 33 COSMIC
COSN30466292 48 COSMIC
COSN31562521 79 COSMIC
COSN7202174 85 COSMIC
COSN21765166 172 COSMIC
COSN20095991 256 COSMIC
COSN21553440 332 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs963462067 6 dbSNP
rs1299775069 15 dbSNP
rs1420126692 18 dbSNP
rs1359805630 25 dbSNP
rs767942854 27 dbSNP
rs933759108 31 dbSNP
rs1424970735 32 dbSNP
rs767694541 32 dbSNP
rs1180874231 34 dbSNP
rs1238115148 37 dbSNP
rs750939377 38 dbSNP
rs1489365690 39 dbSNP
rs1185962002 46 dbSNP
rs1386003340 47 dbSNP
rs36052458 49 dbSNP
rs752964625 50 dbSNP
rs756135404 50 dbSNP
rs1457455053 51 dbSNP
rs1264937549 73 dbSNP
rs886981316 74 dbSNP
rs974432118 79 dbSNP
rs921618674 80 dbSNP
rs1003989661 84 dbSNP
rs932967375 99 dbSNP
rs1227852809 106 dbSNP
rs770118538 108 dbSNP
rs775756706 109 dbSNP
rs987375475 110 dbSNP
rs1280394270 113 dbSNP
rs913124901 120 dbSNP
rs1296209056 126 dbSNP
rs1261477109 131 dbSNP
rs1459403832 131 dbSNP
rs898435507 133 dbSNP
rs78080241 140 dbSNP
rs1425311549 143 dbSNP
rs113803011 148 dbSNP
rs1462004106 151 dbSNP
rs904314339 158 dbSNP
rs867761210 176 dbSNP
rs1262947200 178 dbSNP
rs1185247153 179 dbSNP
rs554234048 180 dbSNP
rs1325883805 185 dbSNP
rs369180766 189 dbSNP
rs895838091 197 dbSNP
rs1332849829 202 dbSNP
rs1260159763 218 dbSNP
rs1219492911 224 dbSNP
rs1384380241 227 dbSNP
rs1323126408 233 dbSNP
rs767416181 237 dbSNP
rs1319395899 238 dbSNP
rs1388343295 239 dbSNP
rs1368191778 243 dbSNP
rs4179 249 dbSNP
rs71731047 249 dbSNP
rs1032164188 250 dbSNP
rs77395317 253 dbSNP
rs1216484904 256 dbSNP
rs1331543021 256 dbSNP
rs1464805557 256 dbSNP
rs1421071265 264 dbSNP
rs956259279 265 dbSNP
rs1435339046 273 dbSNP
rs1426473007 276 dbSNP
rs1048776 284 dbSNP
rs1191124091 296 dbSNP
rs1294710679 298 dbSNP
rs1014245980 308 dbSNP
rs1240130721 316 dbSNP
rs1334970393 326 dbSNP
rs1025936075 328 dbSNP
rs113921313 329 dbSNP
rs546147161 330 dbSNP
rs1205583080 331 dbSNP
rs1235128152 332 dbSNP
rs547436183 333 dbSNP
rs748105127 333 dbSNP
rs1232010252 336 dbSNP
rs887355142 340 dbSNP
rs1378420806 343 dbSNP
rs752181802 347 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggagaucauuuauacAGUCGUa 5'
                         |||||| 
Target 5' --------------uUCAGCAa 3'
 		1 - 8
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000366957.5 | 3UTR | UUCAGCAAGCUCAAGUCUUCUCCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.72 3.6e-5 -0.696 7.9e-5 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.743 1.1e-2 0.767 7.9e-3 9 Click to see details
GSE17498 Multiple myeloma 0.324 2.1e-2 0.257 5.5e-2 40 Click to see details
GSE19536 Breast cancer -0.186 3.2e-2 -0.225 1.2e-2 100 Click to see details
GSE19350 CNS germ cell tumors -0.495 5.1e-2 -0.316 1.6e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.321 8.4e-2 0.463 2.0e-2 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.264 1.1e-1 0.303 8.0e-2 23 Click to see details
GSE28260 Renal cortex and medulla 0.358 1.1e-1 0.225 2.3e-1 13 Click to see details
GSE19783 ER- ER- breast cancer -0.132 1.2e-1 -0.152 9.1e-2 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.244 1.5e-1 -0.188 2.1e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.173 1.7e-1 -0.228 1.0e-1 32 Click to see details
GSE21687 Ependynoma primary tumors -0.095 2.3e-1 -0.254 2.1e-2 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.095 3.3e-1 0.071 3.7e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.097 3.3e-1 0.013 4.8e-1 24 Click to see details
GSE38226 Liver fibrosis 0.047 4.2e-1 0.075 3.7e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.037 4.3e-1 0.513 4.4e-3 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.353 0.01 -0.360 0.01 49 Click to see details
ESCA 0.577 0.03 0.618 0.02 11 Click to see details
THCA -0.213 0.05 -0.157 0.12 59 Click to see details
PCPG 0.974 0.07 0.500 0.33 3 Click to see details
STAD 0.233 0.1 0.275 0.06 32 Click to see details
KIRP -0.164 0.18 -0.153 0.2 32 Click to see details
BRCA 0.099 0.19 0.160 0.07 84 Click to see details
CHOL -0.339 0.19 -0.233 0.27 9 Click to see details
KICH -0.163 0.22 -0.072 0.37 25 Click to see details
LUSC 0.13 0.22 0.120 0.24 38 Click to see details
PAAD -0.522 0.24 -0.600 0.2 4 Click to see details
HNSC -0.107 0.25 -0.156 0.16 42 Click to see details
BLCA 0.157 0.27 0.137 0.29 18 Click to see details
PRAD 0.088 0.27 0.016 0.46 50 Click to see details
CESC 0.452 0.35 0.500 0.33 3 Click to see details
KIRC 0.035 0.39 0.089 0.24 68 Click to see details
UCEC -0.032 0.45 0.049 0.42 19 Click to see details
LUAD 0.04 0.45 -0.070 0.41 12 Click to see details
LUAD 0.04 0.45 -0.070 0.41 12 Click to see details
44 hsa-miR-628-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT037783 NELFE negative elongation factor complex member E 1 1
MIRT200944 ZNF264 zinc finger protein 264 2 6
MIRT441916 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT443436 PLSCR1 phospholipid scramblase 1 2 2
MIRT443447 CLIC5 chloride intracellular channel 5 2 2
MIRT443906 ZNF256 zinc finger protein 256 2 2
MIRT449750 SMYD2 SET and MYND domain containing 2 2 2
MIRT461377 SLFN12L schlafen family member 12 like 2 2
MIRT466416 TFAP2A transcription factor AP-2 alpha 2 8
MIRT486594 CTPS2 CTP synthase 2 2 2
MIRT491945 VPS52 VPS52, GARP complex subunit 2 2
MIRT513492 SSR1 signal sequence receptor subunit 1 2 6
MIRT528599 ZNF326 zinc finger protein 326 2 2
MIRT531325 SEMA3D semaphorin 3D 2 2
MIRT532082 RTTN rotatin 2 2
MIRT532563 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT532976 ZNF12 zinc finger protein 12 2 2
MIRT534075 SREK1IP1 SREK1 interacting protein 1 2 2
MIRT536103 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT536183 MAOB monoamine oxidase B 2 2
MIRT543755 UBXN2B UBX domain protein 2B 2 2
MIRT550000 KIAA0408 KIAA0408 2 2
MIRT551237 COLEC10 collectin subfamily member 10 2 2
MIRT567554 FEN1 flap structure-specific endonuclease 1 2 2
MIRT570387 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 2
MIRT570808 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT576346 Pxdn peroxidasin 2 2
MIRT576520 Txlna taxilin alpha 2 2
MIRT576893 Poteg POTE ankyrin domain family, member G 2 2
MIRT606796 BICD2 BICD cargo adaptor 2 2 2
MIRT625909 GBP6 guanylate binding protein family member 6 2 2
MIRT626869 PDGFRA platelet derived growth factor receptor alpha 2 2
MIRT643603 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT645451 FOXE1 forkhead box E1 2 2
MIRT652265 TOMM20 translocase of outer mitochondrial membrane 20 2 2
MIRT689023 ARID1A AT-rich interaction domain 1A 2 2
MIRT691057 CRCP CGRP receptor component 2 2
MIRT704712 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT713069 ENTHD1 ENTH domain containing 1 2 2
MIRT719483 RBM27 RNA binding motif protein 27 2 2
MIRT732944 AGAP2-AS1 AGAP2 antisense RNA 1 3 0
MIRT732945 KLF12 Kruppel like factor 12 3 0
MIRT733520 BMP2 bone morphogenetic protein 2 3 0
MIRT733521 ETV1 ETS variant 1 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-628-5p 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-628 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-628-5p Sunitinib 5329102 NSC750690 approved sensitive Low Renal Cell Cancer tissue
hsa-miR-628-5p Sunitinib 5329102 NSC750690 approved sensitive Low Renal Cell Cancer cell line (OS-RC-2)
hsa-miR-628-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line
hsa-miR-628-5p Dabrafenib + Trametinib sensitive High Melanoma cell line
hsa-miR-628-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line
hsa-miR-628-5p Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-628-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-628-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-628-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-628-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-628-5p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-628-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-628-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-628-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-628-5p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-628-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-628-5p Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-miR-628-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission