miRTarBase - #MIRT450003


—
pre-miRNA Information
pre-miRNA hsa-mir-605   
Genomic Coordinates chr10: 51299573 - 51299655
Synonyms MIRN605, hsa-mir-605, MIR605
Description Homo sapiens miR-605 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-605-3p
Sequence 51| AGAAGGCACUAUGAGAUUUAGA |72
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 10 + 51299626 27587585, 28550310, 26028588, 26449202, 26487287, 29165639 MiREDiBase
A-to-I 14 10 + 51299636 29233923 MiREDiBase
A-to-I 20 10 + 51299642 18684997, 26449202, 27587585, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs759219082 5 dbSNP
rs1491224174 9 dbSNP
rs746611214 10 dbSNP
rs367648737 11 dbSNP
rs1359467239 14 dbSNP
rs1442565019 16 dbSNP
Putative Targets

Gene Information
Gene Symbol HAX1   
Synonyms HCLSBP1, HS1BP1, SCN3
Description HCLS1 associated protein X-1
Transcript NM_001018837   
Other Transcripts NM_006118   
Expression
Putative miRNA Targets on HAX1
3'UTR of HAX1
(miRNA target sites are highlighted)		 
>HAX1|NM_001018837|3'UTR
   1 CCTTGTTAACCCTCAGAGGCCTTCAAGTCCTTTCCACCTCTCACCCATTGCCCACCATTAATAAGCTTAGCTTCTCTTGC
  81 CACCTCAGGGGCTTGGATATGTGGAATAGTGAACTGGGGCCATGTCAGTTTGTCACTCACCCAAACTGACCAATAAAACC
 161 TTTATTTATGCTAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agAUUUAGAGUAUCACGGAAGa 5'
            |||  |||| |  |||||| 
Target 5' gtTAACCCTCAGA-GGCCTTCa 3'
 5 - 25 131.00 -14.60
2 
miRNA  3' agauuuAGAGU--AUCACGGaaga 5'
                |||||   | ||||    
Target 5' tccaccTCTCACCCATTGCCcacc 3'
 33 - 56 94.00 -6.36
3 
miRNA  3' agAUU----UAGAGUAUCACGGaaga 5'
            |||    | ||: |  ||||    
Target 5' aaTAAGCTTAGCTTCTCTTGCCacct 3'
 60 - 85 90.00 -7.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
292708 2 ClinVar
292709 48 ClinVar
874307 81 ClinVar
COSN30481666 11 COSMIC
COSN30499717 20 COSMIC
COSN31488523 25 COSMIC
COSN31516865 64 COSMIC
COSN30113901 75 COSMIC
COSN28195625 82 COSMIC
COSN31483536 87 COSMIC
COSN23857759 96 COSMIC
COSN20073947 113 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747961567 2 dbSNP
rs918743699 6 dbSNP
rs1357946637 12 dbSNP
rs1446265245 13 dbSNP
rs1184105998 19 dbSNP
rs1440774197 20 dbSNP
rs769582304 21 dbSNP
rs747309920 24 dbSNP
rs1160569809 25 dbSNP
rs762580184 27 dbSNP
rs770514407 28 dbSNP
rs14680 31 dbSNP
rs773885551 32 dbSNP
rs759997225 35 dbSNP
rs1403957800 36 dbSNP
rs541236904 37 dbSNP
rs1416176564 38 dbSNP
rs1454964696 39 dbSNP
rs1192046167 40 dbSNP
rs753065735 41 dbSNP
rs1387774108 42 dbSNP
rs987062208 43 dbSNP
rs183456651 48 dbSNP
rs764307086 51 dbSNP
rs944335405 53 dbSNP
rs1180652792 56 dbSNP
rs987223907 58 dbSNP
rs41315563 65 dbSNP
rs1252305359 66 dbSNP
rs1219064716 67 dbSNP
rs912619566 81 dbSNP
rs974387986 84 dbSNP
rs1222822739 87 dbSNP
rs977251270 89 dbSNP
rs578021129 92 dbSNP
rs751845152 93 dbSNP
rs1378207670 102 dbSNP
rs545321258 103 dbSNP
rs1293490262 105 dbSNP
rs1368791573 108 dbSNP
rs1434702589 112 dbSNP
rs1233746370 115 dbSNP
rs1256795107 120 dbSNP
rs935747682 121 dbSNP
rs935891242 124 dbSNP
rs1487259190 125 dbSNP
rs1192400660 127 dbSNP
rs1378712847 133 dbSNP
rs1160464106 137 dbSNP
rs1440433623 142 dbSNP
rs1394355182 152 dbSNP
rs990107227 161 dbSNP
rs563715242 169 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agauuuagAGUAUCACGGAAGa 5'
                  ||| ||| |:||| 
Target 5' --------UCA-AGUCCUUUCc 3'
 		1 - 13
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000328703.7 | 3UTR | UCAAGUCCUUUCCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
100 hsa-miR-605-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061339 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT061584 BTG2 BTG anti-proliferation factor 2 2 6
MIRT076140 WDR81 WD repeat domain 81 2 2
MIRT079361 CCDC137 coiled-coil domain containing 137 2 2
MIRT079547 VAMP3 vesicle associated membrane protein 3 2 2
MIRT096242 CANX calnexin 2 2
MIRT243877 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT249186 AKIRIN1 akirin 1 2 8
MIRT273604 SP1 Sp1 transcription factor 2 2
MIRT316766 FOXC1 forkhead box C1 2 4
MIRT322410 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT370117 TRIB3 tribbles pseudokinase 3 2 2
MIRT392725 UBN2 ubinuclein 2 2 2
MIRT406910 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT407440 CTDSP1 CTD small phosphatase 1 2 2
MIRT441887 RD3 retinal degeneration 3 2 4
MIRT444979 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT445241 FOXD4 forkhead box D4 2 2
MIRT445500 FOXD4L5 forkhead box D4 like 5 2 2
MIRT445503 FOXD4L4 forkhead box D4 like 4 2 2
MIRT447025 FOXD4L1 forkhead box D4 like 1 2 2
MIRT447743 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT448761 HDX highly divergent homeobox 2 2
MIRT450003 HAX1 HCLS1 associated protein X-1 2 2
MIRT452830 FAM131B family with sequence similarity 131 member B 2 2
MIRT452872 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT453506 ARRB1 arrestin beta 1 2 2
MIRT454169 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT458742 CES2 carboxylesterase 2 2 2
MIRT459166 HSPA6 heat shock protein family A (Hsp70) member 6 2 21
MIRT460246 IL17RB interleukin 17 receptor B 2 4
MIRT460514 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT460698 RNF157 ring finger protein 157 2 2
MIRT461481 METTL1 methyltransferase like 1 2 2
MIRT462617 C20orf27 chromosome 20 open reading frame 27 2 4
MIRT463233 ZNF131 zinc finger protein 131 2 2
MIRT465699 TNPO2 transportin 2 2 8
MIRT466304 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT468957 RPS14 ribosomal protein S14 2 6
MIRT469571 RARA retinoic acid receptor alpha 2 2
MIRT469685 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT470800 PMP22 peripheral myelin protein 22 2 2
MIRT471649 PANK2 pantothenate kinase 2 2 4
MIRT471722 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472281 NFIB nuclear factor I B 2 4
MIRT473680 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT475859 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT477326 EPHA2 EPH receptor A2 2 2
MIRT477831 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478572 CTNND1 catenin delta 1 2 4
MIRT479634 CD81 CD81 molecule 2 2
MIRT481950 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483696 ZNF74 zinc finger protein 74 2 6
MIRT488798 MALT1 MALT1 paracaspase 2 2
MIRT489066 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT492533 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT492857 NRARP NOTCH regulated ankyrin repeat protein 2 2
MIRT496793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT500122 ZNF106 zinc finger protein 106 2 4
MIRT505359 TMEM167A transmembrane protein 167A 2 2
MIRT506786 KLHL15 kelch like family member 15 2 6
MIRT510692 SRM spermidine synthase 2 6
MIRT515841 CEP104 centrosomal protein 104 2 4
MIRT516448 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 4
MIRT528855 PKP1 plakophilin 1 2 2
MIRT533848 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT539025 ATXN7L1 ataxin 7 like 1 2 4
MIRT542872 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT546543 SATB2 SATB homeobox 2 2 2
MIRT554114 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT560569 ZNF460 zinc finger protein 460 2 2
MIRT560796 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT562836 GCFC2 GC-rich sequence DNA-binding factor 2 2 2
MIRT563109 IFRD2 interferon related developmental regulator 2 2 2
MIRT564177 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT564283 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT564350 USP22 ubiquitin specific peptidase 22 2 2
MIRT565279 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT565338 TMEM104 transmembrane protein 104 2 2
MIRT565905 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT567108 ITGB1 integrin subunit beta 1 2 2
MIRT567601 FANCF Fanconi anemia complementation group F 2 2
MIRT567779 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT568075 CENPQ centromere protein Q 2 2
MIRT624304 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT644395 CDKL1 cyclin dependent kinase like 1 2 2
MIRT661547 ZNF674 zinc finger protein 674 2 4
MIRT670949 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT672951 AKAP5 A-kinase anchoring protein 5 2 2
MIRT697426 ZFP36 ZFP36 ring finger protein 2 2
MIRT700793 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT702657 ITGA3 integrin subunit alpha 3 2 2
MIRT708945 FZR1 fizzy and cell division cycle 20 related 1 2 2
MIRT713657 PLCE1 phospholipase C epsilon 1 2 2
MIRT719239 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT719951 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT722048 HLA-E major histocompatibility complex, class I, E 2 2
MIRT722201 URM1 ubiquitin related modifier 1 2 2
MIRT724790 C1D C1D nuclear receptor corepressor 2 2
MIRT734347 CYP2B6 cytochrome P450 family 2 subfamily B member 6 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-605 Anthranilamide-pyrazolo[1,5-a]pyrimidine NULL NULL Quantitative real-time PCR neuroblastoma cells 23992861 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-605 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-605 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-605-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)

Error report submission