pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6839 |
Genomic Coordinates | chr7: 64679064 - 64679176 |
Description | Homo sapiens miR-6839 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6839-3p | ||||||||||||
Sequence | 92| UUGGGUUUUCUCUUCAAUCCAG |113 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | OR2A4 | ||||||||||||||||||||
Synonyms | OR2A10 | ||||||||||||||||||||
Description | olfactory receptor family 2 subfamily A member 4 | ||||||||||||||||||||
Transcript | NM_030908 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on OR2A4 | |||||||||||||||||||||
3'UTR of OR2A4 (miRNA target sites are highlighted) |
>OR2A4|NM_030908|3'UTR 1 AAAGGATTATGGCATTGTGACTGACAGTGACCTAGGAAGTTACATCATTGAGCGGTTCTTAACCCATCTCTGCACTGGTG 81 GGACCTCTGCCCTCAATGGACATGAGAATTATCTGAGACATTTATTTAAAATGGAGCTATCTCCTGCCCTACCTTTAAAT 161 GACTGATTTCAGCAGATGTGGGATGAAATTCTAGAAATTGATCTCTTCAAGTTGTGCTGCAGCCACTCCACACCAGGACA 241 ATACCCCTTACAATATCCTCATTAGCTTTTGATCCAGTCCCATACCTCCCATAATGTTTTCCTCAAAACACTGGTCCCTT 321 CAGAGGACTTTAAAAATAAGTTCTATAGTCAAATAAGTTTGAGACTTACTTCACATCAGATGCCTCTGTCTAGGGATCAC 401 AATTCATATTAGCATAGTGAATGCTGTAAATATTTCTCTAGGAAAGAATAATTCTATACCAGCTTTAAGCCAGTGTTTTC 481 TAAACTTATGTGAGCACATAAAATTTCCTTTGTAATACTTAGTAACAGTTTCCTGGAACAGGAGATCTTGATATTAATTG 561 ACTCATTGTGAATACTTCCTACAGCCCCCTTCTAGGGCAGAATGATTTCTTTTTTCCTTGCAAAGTGAGCCTCTAAAGAG 641 ATGTAGTTCTGAGCATTATGCCTCGATCAGTCTGTAAAAATCCGGGTTCTGTTTGGATACAGACCGTGAGGGACCCTGTC 721 TCTACTGTTCAATGGTAGATCATCTAAAGAAAATAAATGCAATCCTGTCCTTCATCATGGATCGGCATTCCTGCTATAGA 801 AGCTTCAGGAGATGACCTCATTCAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | BC-1 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine
... - Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Gottwein E; Corcoran DL; Mukherjee N; et al. - Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
|
CLIP-seq Support 1 for dataset GSM796037 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | BC-1 / 4-Thiouridine |
Location of target site | ENST00000315453.2 | 3UTR | UCAAGAUAAACCCAGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22100165 / GSE32109 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
62 hsa-miR-6839-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT059162 | TXNIP | thioredoxin interacting protein | 2 | 2 | ||||||||
MIRT064872 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 2 | ||||||||
MIRT065802 | HOXC8 | homeobox C8 | 2 | 4 | ||||||||
MIRT106005 | SDCBP | syndecan binding protein | 2 | 2 | ||||||||
MIRT275773 | TFDP1 | transcription factor Dp-1 | 2 | 2 | ||||||||
MIRT314032 | PAPD7 | poly(A) RNA polymerase D7, non-canonical | 2 | 2 | ||||||||
MIRT360277 | HIST1H2BE | histone cluster 1 H2B family member e | 2 | 8 | ||||||||
MIRT360301 | HIST1H2BH | histone cluster 1 H2B family member h | 2 | 2 | ||||||||
MIRT450086 | OR2A4 | olfactory receptor family 2 subfamily A member 4 | 2 | 2 | ||||||||
MIRT468815 | RSRC2 | arginine and serine rich coiled-coil 2 | 2 | 6 | ||||||||
MIRT475093 | IRF2BP2 | interferon regulatory factor 2 binding protein 2 | 2 | 4 | ||||||||
MIRT477575 | EIF1AD | eukaryotic translation initiation factor 1A domain containing | 2 | 2 | ||||||||
MIRT483926 | LCORL | ligand dependent nuclear receptor corepressor like | 2 | 6 | ||||||||
MIRT504381 | HIST1H1C | histone cluster 1 H1 family member c | 2 | 4 | ||||||||
MIRT506970 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | 2 | 6 | ||||||||
MIRT507028 | HIST1H3B | histone cluster 1 H3 family member b | 2 | 6 | ||||||||
MIRT511561 | HIST3H2BB | histone cluster 3 H2B family member b | 2 | 4 | ||||||||
MIRT511650 | HIST1H3D | histone cluster 1 H3 family member d | 2 | 6 | ||||||||
MIRT511696 | HIST1H2BL | histone cluster 1 H2B family member l | 2 | 4 | ||||||||
MIRT511737 | HIST1H2BB | histone cluster 1 H2B family member b | 2 | 6 | ||||||||
MIRT511746 | HIST1H2BA | histone cluster 1 H2B family member a | 2 | 8 | ||||||||
MIRT515260 | CSNK1E | casein kinase 1 epsilon | 2 | 2 | ||||||||
MIRT516220 | RAB3B | RAB3B, member RAS oncogene family | 2 | 4 | ||||||||
MIRT523281 | HIST1H1E | histone cluster 1 H1 family member e | 2 | 2 | ||||||||
MIRT524121 | DMXL1 | Dmx like 1 | 2 | 2 | ||||||||
MIRT530744 | GPR82 | G protein-coupled receptor 82 | 2 | 2 | ||||||||
MIRT532214 | CCDC117 | coiled-coil domain containing 117 | 2 | 2 | ||||||||
MIRT546182 | TPRG1L | tumor protein p63 regulated 1 like | 2 | 2 | ||||||||
MIRT558638 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | 2 | 2 | ||||||||
MIRT559562 | ARF1 | ADP ribosylation factor 1 | 2 | 4 | ||||||||
MIRT560680 | HIST1H1T | histone cluster 1 H1 family member t | 2 | 2 | ||||||||
MIRT570746 | AAK1 | AP2 associated kinase 1 | 2 | 2 | ||||||||
MIRT609518 | RAB3IP | RAB3A interacting protein | 2 | 2 | ||||||||
MIRT612583 | SYNGAP1 | synaptic Ras GTPase activating protein 1 | 2 | 4 | ||||||||
MIRT615733 | RIOK3 | RIO kinase 3 | 2 | 2 | ||||||||
MIRT616068 | SIX1 | SIX homeobox 1 | 2 | 2 | ||||||||
MIRT617903 | SGCD | sarcoglycan delta | 2 | 2 | ||||||||
MIRT620851 | SERPING1 | serpin family G member 1 | 2 | 2 | ||||||||
MIRT625107 | SLC1A5 | solute carrier family 1 member 5 | 2 | 2 | ||||||||
MIRT625120 | NUP93 | nucleoporin 93 | 2 | 2 | ||||||||
MIRT625893 | LINC00632 | long intergenic non-protein coding RNA 632 | 2 | 2 | ||||||||
MIRT626569 | MED7 | mediator complex subunit 7 | 2 | 2 | ||||||||
MIRT626694 | ZFP14 | ZFP14 zinc finger protein | 2 | 4 | ||||||||
MIRT626808 | PRR11 | proline rich 11 | 2 | 2 | ||||||||
MIRT628131 | HM13 | histocompatibility minor 13 | 2 | 2 | ||||||||
MIRT636596 | DCAF5 | DDB1 and CUL4 associated factor 5 | 2 | 2 | ||||||||
MIRT649866 | SLFN12L | schlafen family member 12 like | 2 | 2 | ||||||||
MIRT652133 | TRPM7 | transient receptor potential cation channel subfamily M member 7 | 2 | 2 | ||||||||
MIRT652663 | TIMELESS | timeless circadian clock | 2 | 2 | ||||||||
MIRT658335 | FAM83D | family with sequence similarity 83 member D | 2 | 2 | ||||||||
MIRT660615 | ANKS4B | ankyrin repeat and sterile alpha motif domain containing 4B | 2 | 2 | ||||||||
MIRT666304 | SLC22A3 | solute carrier family 22 member 3 | 2 | 2 | ||||||||
MIRT668528 | ERGIC2 | ERGIC and golgi 2 | 2 | 2 | ||||||||
MIRT692510 | PARD3 | par-3 family cell polarity regulator | 2 | 2 | ||||||||
MIRT694784 | DHFRL1 | dihydrofolate reductase 2 | 2 | 2 | ||||||||
MIRT700510 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | 2 | 2 | ||||||||
MIRT701438 | NFYA | nuclear transcription factor Y subunit alpha | 2 | 2 | ||||||||
MIRT710155 | MTRF1L | mitochondrial translational release factor 1 like | 2 | 2 | ||||||||
MIRT711436 | DLC1 | DLC1 Rho GTPase activating protein | 2 | 2 | ||||||||
MIRT716979 | GPR155 | G protein-coupled receptor 155 | 2 | 2 | ||||||||
MIRT720155 | POU2F2 | POU class 2 homeobox 2 | 2 | 2 | ||||||||
MIRT722512 | DSTYK | dual serine/threonine and tyrosine protein kinase | 2 | 2 |