miRTarBase - #MIRT450683


—
pre-miRNA Information
pre-miRNA hsa-mir-7156   
Genomic Coordinates chr1: 77060143 - 77060202
Description Homo sapiens miR-7156 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7156-5p
Sequence 1| UUGUUCUCAAACUGGCUGUCAGA |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs907711107 9 dbSNP
rs940406061 22 dbSNP
Putative Targets

Gene Information
Gene Symbol RPN2   
Synonyms RIBIIR, RPN-II, RPNII, SWP1
Description ribophorin II
Transcript NM_001135771   
Other Transcripts NM_002951   
Expression
Putative miRNA Targets on RPN2
3'UTR of RPN2
(miRNA target sites are highlighted)		 
>RPN2|NM_001135771|3'UTR
   1 TTCCAGAAGAAAGATGGAAATTCTGAAAACTGAATGTCAAGAAAAGGAGTCAAGAACAATTCACAGTATGAGAAGAAAAA
  81 TGGAAAAAAAAAACTTTATTTAAAAAAGAAAAAAGTCCAGATTGTAGTTATACTTTTGCTTGTTTTTCAGTTTCCCCAAC
 161 ACACAGCAGATACCTGGTGAGCTCAGATAGTCTCTTTCTCTGACACTGTGTAAGAAGCTGTGAATATTCCTAACTTACCC
 241 AGATGTTGCTTTTGAAAAGTTGAAATGTGTAATTGTTTTGGAATAAAGAGGGTAACAATAGGAACAAAAAAAAAAAAAAA
 321 AAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agacUGUCG---GUCAAACUCUUGUu 5'
              ||| :   |||| |||||| | 
Target 5' aagaACAATTCACAGTATGAGAAGAa 3'
 52 - 77 131.00 -12.50
2 
miRNA  3' agACUGU----CGGUC--AAACUCUUGUu 5'
            |||||    |: ||    || |||:| 
Target 5' tcTGACACTGTGTAAGAAGCTGTGAATAt 3'
 199 - 227 105.00 -9.70
3 
miRNA  3' agacugucggucaaacUCUUGUu 5'
                          :||||| 
Target 5' aaagagggtaacaataGGAACAa 3'
 285 - 307 104.00 -8.34
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30158578 53 COSMIC
COSN510486 85 COSMIC
COSN30124971 86 COSMIC
COSN1248277 94 COSMIC
COSN27589313 94 COSMIC
COSN31593320 110 COSMIC
COSN30158574 114 COSMIC
COSN13859793 123 COSMIC
COSN31522967 130 COSMIC
COSN15139526 177 COSMIC
COSN31585200 243 COSMIC
COSN21737389 289 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773906206 1 dbSNP
rs1016046655 2 dbSNP
rs759319574 3 dbSNP
rs1254638894 4 dbSNP
rs370660340 5 dbSNP
rs1201272689 7 dbSNP
rs1232153205 7 dbSNP
rs374164943 8 dbSNP
rs1487377235 10 dbSNP
rs979577651 14 dbSNP
rs371416564 15 dbSNP
rs1425769119 24 dbSNP
rs368535696 29 dbSNP
rs1308596738 30 dbSNP
rs1411420588 36 dbSNP
rs1238527413 39 dbSNP
rs754506386 39 dbSNP
rs1399868396 41 dbSNP
rs778738115 41 dbSNP
rs558320367 47 dbSNP
rs1467361333 55 dbSNP
rs1173937525 58 dbSNP
rs1379623482 60 dbSNP
rs1466687309 60 dbSNP
rs1359487301 65 dbSNP
rs778930989 69 dbSNP
rs1299505715 76 dbSNP
rs745951607 81 dbSNP
rs1386726653 82 dbSNP
rs1299764753 83 dbSNP
rs11539064 84 dbSNP
rs747754200 84 dbSNP
rs772500028 84 dbSNP
rs758671021 85 dbSNP
rs777935139 90 dbSNP
rs954454736 90 dbSNP
rs1422422484 91 dbSNP
rs1255826394 93 dbSNP
rs747397645 94 dbSNP
rs1234395652 95 dbSNP
rs780221831 97 dbSNP
rs149922061 99 dbSNP
rs1483344556 102 dbSNP
rs538821662 106 dbSNP
rs1264026607 109 dbSNP
rs1488175604 113 dbSNP
rs781722865 115 dbSNP
rs554859248 117 dbSNP
rs777067446 122 dbSNP
rs912946032 129 dbSNP
rs200844150 131 dbSNP
rs773780800 133 dbSNP
rs1417497131 137 dbSNP
rs1396416333 146 dbSNP
rs572333092 149 dbSNP
rs1404596493 151 dbSNP
rs542909408 155 dbSNP
rs931009466 160 dbSNP
rs1801447 173 dbSNP
rs1389548115 176 dbSNP
rs1161483627 182 dbSNP
rs1048720196 183 dbSNP
rs1368419836 185 dbSNP
rs529203920 187 dbSNP
rs942967424 191 dbSNP
rs1041283766 194 dbSNP
rs1268130455 207 dbSNP
rs1464168349 207 dbSNP
rs561286946 208 dbSNP
rs575988254 235 dbSNP
rs929968206 237 dbSNP
rs1384808361 244 dbSNP
rs1047599581 253 dbSNP
rs1434574475 268 dbSNP
rs1366209271 284 dbSNP
rs1256638393 285 dbSNP
rs765872150 296 dbSNP
rs1322579286 297 dbSNP
rs1403725338 299 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agacugucggucaaacUCUUGUu 5'
                          |||||| 
Target 5' -------------ucaAGAACAa 3'
 		1 - 10
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000237530.6 | 3UTR | ucaagaacaauucacag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
71 hsa-miR-7156-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071889 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT089448 STAMBP STAM binding protein 2 2
MIRT135061 ADSS adenylosuccinate synthase 2 4
MIRT279713 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT314693 TMEM167A transmembrane protein 167A 2 2
MIRT405292 ARF1 ADP ribosylation factor 1 2 2
MIRT449941 IGF1 insulin like growth factor 1 2 2
MIRT450241 TRIM66 tripartite motif containing 66 2 2
MIRT450266 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450683 RPN2 ribophorin II 2 2
MIRT465595 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT479853 CCDC6 coiled-coil domain containing 6 2 2
MIRT487158 IFRD1 interferon related developmental regulator 1 2 6
MIRT506338 NUP54 nucleoporin 54 2 4
MIRT514596 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT525340 TUBGCP4 tubulin gamma complex associated protein 4 2 2
MIRT528088 UCHL3 ubiquitin C-terminal hydrolase L3 2 2
MIRT529251 TRIM4 tripartite motif containing 4 2 4
MIRT552786 YAF2 YY1 associated factor 2 2 2
MIRT554463 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT557667 GATA6 GATA binding protein 6 2 2
MIRT565808 SDCCAG3 serologically defined colon cancer antigen 3 2 2
MIRT566342 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567793 DEK DEK proto-oncogene 2 2
MIRT572456 ZNF516 zinc finger protein 516 2 2
MIRT572583 HGFAC HGF activator 2 2
MIRT574650 LMAN2 lectin, mannose binding 2 2 2
MIRT608165 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT612019 PAK6 p21 (RAC1) activated kinase 6 2 8
MIRT616033 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT621925 SYAP1 synapse associated protein 1 2 4
MIRT624611 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT635086 AKIRIN1 akirin 1 2 2
MIRT636154 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT638256 SIX1 SIX homeobox 1 2 2
MIRT638485 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT639396 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT641787 USP32 ubiquitin specific peptidase 32 2 2
MIRT642300 FPR1 formyl peptide receptor 1 2 2
MIRT644555 SPOP speckle type BTB/POZ protein 2 2
MIRT645901 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT657250 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT659907 CACNG2 calcium voltage-gated channel auxiliary subunit gamma 2 2 2
MIRT665371 XIAP X-linked inhibitor of apoptosis 2 2
MIRT667268 NAV1 neuron navigator 1 2 2
MIRT669215 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT674142 ZNF793 zinc finger protein 793 2 2
MIRT698726 STX6 syntaxin 6 2 4
MIRT699789 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT700291 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT710005 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT710408 YTHDC1 YTH domain containing 1 2 2
MIRT710570 TNPO1 transportin 1 2 2
MIRT711055 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711281 PSME3 proteasome activator subunit 3 2 2
MIRT711385 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT712718 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713289 ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif 20 2 2
MIRT715650 USP6NL USP6 N-terminal like 2 2
MIRT716168 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716757 TRABD2A TraB domain containing 2A 2 2
MIRT718362 SOX1 SRY-box 1 2 2
MIRT719672 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT720828 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT722185 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT722400 BCAS2 BCAS2, pre-mRNA processing factor 2 2
MIRT723461 ST8SIA3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 2 2
MIRT724073 NCKAP1L NCK associated protein 1 like 2 2
MIRT724595 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT725235 PDE1B phosphodiesterase 1B 2 2
MIRT725585 CDH7 cadherin 7 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7156 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-7156-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission