>MYH14|NM_001077186|3'UTR
   1 CCCTACCCTGTCCCCAGATGCACTAACAGATGGGGCCCAGCCCCCTTCCTCCCTGGACCCCACGGGCCCCTGTCCCAGGA
  81 ACCCCGCCCTCTGACTTCTTGCCCTTTGGAAATGGTGCAGCACTCTGGCATTTATCACCCCCACCTGGGTCCCCTGCAAC
 161 CTCCCATCAAAGGATGACCCCTAAACACAGAGGAGCGGGGCAGGCAGGGAGGCAATGACTGGAGCTACCTTGCTTGTTGG
 241 GGGACTGGGTACAGTTGGCAAGCTGTGTTTCCATCAGCTCCCTGTCCTCCTTTCTTCCCTCGTTATTGATCTATAGACAT
 321 TAGGAAGGGAGTGAGACGGCTCCTCCACCATCCTCAGCCAGTGCAACCCATTCCCTCTGCTTCTCTCTCTCTCTCTCTCT
 401 CTCCCTCCCTCTCCTTCCCTACCCTCTCACCATCTTTCTTGGCCTCTCTGAGGGTCTCTCTGTGCATCTTTTTAGGAATC
 481 TCGCTCTCACTCTCTACGTAGCCACTCTCCTTCCCCCATTTCTGCGTCCACCCCTGAACTCCTGAGCGACAGAAGCCCCA
 561 GGCCTCCACCAGCCTTGAACCCTTGCAAAGGGGCAGGACAAGGGGACCCCTCTCACTCCTGCTGCTGCCCATGCTCTGCC
 641 CTCCCTTCTGGTTGCTCTGAGGGTTCGGAGCTTCCCTCTGGGACTAAAGGAGTGTCCTTTACCCTCCCAGCCTCCAGGCT
 721 CTGGCAGAAATAAACTCCAACCCGACTGGACCATAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ggAGGGUGGGUGAGGGAGu 5' ||:| |:| ||||||| Target 5' tcTCTCTCTCTCTCCCTCc 3'	390 - 408	161.00	-24.10
2	miRNA 3' ggAGGGUGGGUGAGGGAGu 5' | | |||||:|||||| Target 5' agTGCAACCCATTCCCTCt 3'	360 - 378	153.00	-22.20
3	miRNA 3' ggaGGGU-GGGUGAGGGAGu 5' |||| ||| ||:|||| Target 5' gggCCCAGCCCCCTTCCTCc 3'	33 - 52	148.00	-22.60

Mutant ID	Mutant Position	Mutant Source
329953	65	ClinVar
329954	82	ClinVar
894015	87	ClinVar
329955	123	ClinVar
329956	143	ClinVar
329957	145	ClinVar
894417	156	ClinVar
329958	217	ClinVar
329959	244	ClinVar
329960	302	ClinVar
329961	303	ClinVar
329962	338	ClinVar
892974	369	ClinVar
329963	382	ClinVar
329964	382	ClinVar
329965	390	ClinVar
329966	401	ClinVar
892975	428	ClinVar
329967	475	ClinVar
329968	532	ClinVar
893199	605	ClinVar
329969	668	ClinVar
893200	739	ClinVar
COSM8554304	6	COSMIC
COSM7543717	9	COSMIC
COSM6213464	17	COSMIC
COSM8654188	30	COSMIC
COSM8647711	52	COSMIC
COSM8650368	85	COSMIC
COSN9851639	195	COSMIC
COSN1217619	201	COSMIC
COSN32071088	403	COSMIC
COSN1770451	467	COSMIC
COSN17037431	697	COSMIC
COSN16461556	744	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs768153073	1	dbSNP
rs1023277492	2	dbSNP
rs765102545	4	dbSNP
rs1340472326	5	dbSNP
rs1337597373	6	dbSNP
rs1259907744	7	dbSNP
rs769359886	9	dbSNP
rs774314722	11	dbSNP
rs766275446	12	dbSNP
rs1362081087	13	dbSNP
rs1217565196	14	dbSNP
rs1255770083	15	dbSNP
rs371235709	16	dbSNP
rs1438380083	17	dbSNP
rs1204133031	21	dbSNP
rs976576773	27	dbSNP
rs1277788027	33	dbSNP
rs754439562	36	dbSNP
rs1036378772	37	dbSNP
rs1173434296	39	dbSNP
rs1243881862	41	dbSNP
rs1206110385	45	dbSNP
rs1478194377	46	dbSNP
rs1466559533	47	dbSNP
rs1429239889	52	dbSNP
rs1193145624	56	dbSNP
rs780715963	57	dbSNP
rs1479217461	59	dbSNP
rs1030330334	60	dbSNP
rs1181440714	61	dbSNP
rs956269769	62	dbSNP
rs752312470	63	dbSNP
rs755809721	64	dbSNP
rs779130953	65	dbSNP
rs1345205563	68	dbSNP
rs1460782789	69	dbSNP
rs572631657	72	dbSNP
rs1275904041	76	dbSNP
rs772326631	82	dbSNP
rs780550154	86	dbSNP
rs772673014	87	dbSNP
rs1236495276	89	dbSNP
rs1169353101	96	dbSNP
rs546411129	101	dbSNP
rs1225332176	107	dbSNP
rs761718453	111	dbSNP
rs968806542	113	dbSNP
rs776901343	115	dbSNP
rs911210577	117	dbSNP
rs1490887418	122	dbSNP
rs12978083	123	dbSNP
rs766679106	125	dbSNP
rs1477252392	129	dbSNP
rs1416512577	134	dbSNP
rs1160781191	135	dbSNP
rs556063581	139	dbSNP
rs1057321857	142	dbSNP
rs770209944	143	dbSNP
rs773312540	145	dbSNP
rs1040963691	150	dbSNP
rs918532693	156	dbSNP
rs929791430	157	dbSNP
rs929654417	171	dbSNP
rs1235649838	174	dbSNP
rs1048705015	176	dbSNP
rs1465796826	180	dbSNP
rs1048111587	191	dbSNP
rs576031713	198	dbSNP
rs1210935131	201	dbSNP
rs1011966126	202	dbSNP
rs888002456	209	dbSNP
rs627491	217	dbSNP
rs1244586974	219	dbSNP
rs1454127431	226	dbSNP
rs1039165394	242	dbSNP
rs561898739	244	dbSNP
rs1360270680	250	dbSNP
rs1318020535	254	dbSNP
rs1418255216	257	dbSNP
rs1362626543	262	dbSNP
rs1003661286	269	dbSNP
rs1035941349	274	dbSNP
rs1387812161	282	dbSNP
rs529409417	302	dbSNP
rs544178350	303	dbSNP
rs1391962876	305	dbSNP
rs1473064946	307	dbSNP
rs1386011754	320	dbSNP
rs1241450789	334	dbSNP
rs753307318	338	dbSNP
rs1333103900	339	dbSNP
rs186982330	354	dbSNP
rs377444835	357	dbSNP
rs1021591833	359	dbSNP
rs968571618	361	dbSNP
rs1291342075	366	dbSNP
rs1287849467	367	dbSNP
rs1380439241	368	dbSNP
rs74582015	369	dbSNP
rs927144911	374	dbSNP
rs79499376	376	dbSNP
rs1187786369	382	dbSNP
rs1418693773	382	dbSNP
rs376379600	382	dbSNP
rs538810577	382	dbSNP
rs761762835	382	dbSNP
rs886054594	382	dbSNP
rs886054595	382	dbSNP
rs918310533	382	dbSNP
rs149455351	390	dbSNP
rs570759880	396	dbSNP
rs1271866256	398	dbSNP
rs1488323521	399	dbSNP
rs1248095191	401	dbSNP
rs886054596	401	dbSNP
rs911348257	403	dbSNP
rs537716543	406	dbSNP
rs1217391761	408	dbSNP
rs1320654768	410	dbSNP
rs1267600832	416	dbSNP
rs1386568472	419	dbSNP
rs1453041387	427	dbSNP
rs190088995	428	dbSNP
rs1410651183	429	dbSNP
rs1437280496	433	dbSNP
rs1053991	439	dbSNP
rs567917288	447	dbSNP
rs1472646722	454	dbSNP
rs1354054473	461	dbSNP
rs1168418686	471	dbSNP
rs886054597	475	dbSNP
rs1161198188	477	dbSNP
rs918471524	483	dbSNP
rs1039728672	484	dbSNP
rs1431241842	485	dbSNP
rs1426813497	488	dbSNP
rs1191477068	490	dbSNP
rs900656819	491	dbSNP
rs929902352	492	dbSNP
rs764240575	498	dbSNP
rs909706020	499	dbSNP
rs1393102210	510	dbSNP
rs947914355	518	dbSNP
rs1053995	523	dbSNP
rs1303643165	526	dbSNP
rs1044791859	527	dbSNP
rs906328498	530	dbSNP
rs886054598	532	dbSNP
rs1003178012	543	dbSNP
rs1351142263	545	dbSNP
rs1052535104	548	dbSNP
rs1291919454	549	dbSNP
rs535549417	553	dbSNP
rs1369788805	557	dbSNP
rs1321709858	561	dbSNP
rs753971693	565	dbSNP
rs1378102583	567	dbSNP
rs1021539838	573	dbSNP
rs1439838976	578	dbSNP
rs968727650	580	dbSNP
rs1200431071	583	dbSNP
rs967091412	594	dbSNP
rs892017404	596	dbSNP
rs1034706318	599	dbSNP
rs1010890570	606	dbSNP
rs1202529988	607	dbSNP
rs960005098	607	dbSNP
rs1250619367	610	dbSNP
rs993043811	610	dbSNP
rs1242388968	611	dbSNP
rs1483062809	627	dbSNP
rs866924363	644	dbSNP
rs1377828288	661	dbSNP
rs1311878870	664	dbSNP
rs553952601	665	dbSNP
rs572169961	667	dbSNP
rs886054599	668	dbSNP
rs1253992561	673	dbSNP
rs1418881973	674	dbSNP
rs1423211481	694	dbSNP
rs1160160666	700	dbSNP
rs1165182964	710	dbSNP
rs1419744731	714	dbSNP
rs1384125578	720	dbSNP
rs1054011	722	dbSNP
rs1369928858	723	dbSNP
rs757578666	726	dbSNP
rs1422537513	736	dbSNP
rs540069517	739	dbSNP
rs567968417	744	dbSNP
rs558366138	745	dbSNP
rs1488199134	751	dbSNP

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2013

BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.