miRTarBase - #MIRT451036


—
pre-miRNA Information
pre-miRNA hsa-mir-4433a   
Genomic Coordinates chr2: 64340759 - 64340839
Description Homo sapiens miR-4433a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4433a-3p
Sequence 51| ACAGGAGUGGGGGUGGGACAU |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs751480515 9 dbSNP
rs557760377 15 dbSNP
rs1479580865 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF610   
Synonyms -
Description zinc finger protein 610
Transcript NM_001161425   
Other Transcripts NM_001161426 , NM_001161427 , NM_173530   
Expression
Putative miRNA Targets on ZNF610
3'UTR of ZNF610
(miRNA target sites are highlighted)		 
>ZNF610|NM_001161425|3'UTR
   1 ATGTGGCAAAATCTTTAGTTAGAATTCACACCTAGCACAACATTGGAGGACTCAGGAGAAAAACCTTACAAATATCATAA
  81 ATGTGGCAAAGAATTTAGTTTGCATTGAAGCCTCATCACTCATCTCTTGATCCACACTGAAAGGAAACCCTACAAATGTA
 161 AAGTTAATAACATATATAAATAATCTATAAAGAGAGAACAGTTATATCAGAATAGAGCATTTAATGAAAACTACCAGTAT
 241 AGCATATTCTTGAGTAGGATTCACATTTAACTGCTGGCACCGTAATTTGTAACTCTTTGATTTAGAATGTACATACTTCT
 321 CATGTTTTAAGTAATAAAGTTTAAAGTTTTTTTTTAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaCAGGGUGG-GGGU-GAGGACa 5'
            | |:||:| |:|| |||:|| 
Target 5' aaGCCTCATCACTCATCTCTTGa 3'
 108 - 130 119.00 -18.30
2 
miRNA  3' uaCAGGGUG-GGGGUGAGGACa 5'
            | ::||| ::: ||| ||| 
Target 5' agGATTCACATTTAACTGCTGg 3'
 256 - 277 119.00 -12.10
3 
miRNA  3' uacAGGGUGG----GGGUGAGGACa 5'
             | ||| :    | :|:||:|| 
Target 5' aacTACCAGTATAGCATATTCTTGa 3'
 229 - 253 112.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30124501 3 COSMIC
COSN30518438 7 COSMIC
COSN31567355 9 COSMIC
COSN30160238 23 COSMIC
COSN31481772 32 COSMIC
COSN15330574 33 COSMIC
COSN30187359 55 COSMIC
COSN30105096 92 COSMIC
COSN8553006 131 COSMIC
COSN29150174 271 COSMIC
COSN20116016 356 COSMIC
COSN26112852 366 COSMIC
COSN22053265 381 COSMIC
COSN1771124 501 COSMIC
COSN1771126 632 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1051017379 3 dbSNP
rs369884651 4 dbSNP
rs201944992 5 dbSNP
rs1249814272 15 dbSNP
rs1411167190 16 dbSNP
rs1484382567 17 dbSNP
rs1393858879 25 dbSNP
rs1167648298 27 dbSNP
rs1444985402 30 dbSNP
rs1054612 33 dbSNP
rs780017371 35 dbSNP
rs1022190344 41 dbSNP
rs746801323 47 dbSNP
rs768533151 50 dbSNP
rs1202193974 62 dbSNP
rs1233395004 68 dbSNP
rs188933323 68 dbSNP
rs537348849 76 dbSNP
rs1436213244 80 dbSNP
rs899275441 84 dbSNP
rs978752798 92 dbSNP
rs1178562055 95 dbSNP
rs1249270914 102 dbSNP
rs1228111250 113 dbSNP
rs1374613229 116 dbSNP
rs1281835758 125 dbSNP
rs376747714 127 dbSNP
rs1352303207 138 dbSNP
rs1307002397 141 dbSNP
rs924599022 154 dbSNP
rs1424849274 156 dbSNP
rs934770949 168 dbSNP
rs1161369109 193 dbSNP
rs1026928761 205 dbSNP
rs886592900 206 dbSNP
rs1178952392 213 dbSNP
rs1468644243 214 dbSNP
rs1251106723 217 dbSNP
rs1200266828 219 dbSNP
rs1004242947 220 dbSNP
rs746023686 224 dbSNP
rs772152266 247 dbSNP
rs1221278241 249 dbSNP
rs1317967403 253 dbSNP
rs1035286049 256 dbSNP
rs992893099 260 dbSNP
rs917450457 278 dbSNP
rs948835586 282 dbSNP
rs536335855 283 dbSNP
rs1346943008 293 dbSNP
rs888663981 301 dbSNP
rs374915559 312 dbSNP
rs191891644 315 dbSNP
rs1435498209 316 dbSNP
rs967817108 331 dbSNP
rs1330578072 336 dbSNP
rs977816207 337 dbSNP
rs923809013 343 dbSNP
rs1177184022 346 dbSNP
rs1036732315 347 dbSNP
rs34331117 347 dbSNP
rs1388625386 348 dbSNP
rs1302009445 351 dbSNP
rs1244137039 352 dbSNP
rs397796837 356 dbSNP
rs200609810 357 dbSNP
rs201981326 358 dbSNP
rs373205865 359 dbSNP
rs1264326597 365 dbSNP
rs199827357 365 dbSNP
rs71335642 365 dbSNP
rs760715048 367 dbSNP
rs997923034 370 dbSNP
rs765138335 371 dbSNP
rs1319014017 376 dbSNP
rs1362235374 380 dbSNP
rs942600503 380 dbSNP
rs889636462 381 dbSNP
rs1387794013 383 dbSNP
rs773153493 386 dbSNP
rs1039026029 388 dbSNP
rs762691833 389 dbSNP
rs930752691 394 dbSNP
rs1022643099 398 dbSNP
rs1047806529 399 dbSNP
rs1429271277 408 dbSNP
rs1250128916 426 dbSNP
rs886641332 431 dbSNP
rs1185091113 433 dbSNP
rs1464765662 434 dbSNP
rs1003716029 439 dbSNP
rs968026906 443 dbSNP
rs978412549 444 dbSNP
rs1253679745 449 dbSNP
rs766133724 450 dbSNP
rs1012489058 451 dbSNP
rs1297337790 464 dbSNP
rs751274766 467 dbSNP
rs1478034061 468 dbSNP
rs956012009 476 dbSNP
rs967702488 477 dbSNP
rs992924135 480 dbSNP
rs1302296244 484 dbSNP
rs754739360 489 dbSNP
rs112558775 490 dbSNP
rs955261718 492 dbSNP
rs986672425 493 dbSNP
rs1459358385 499 dbSNP
rs911020072 503 dbSNP
rs7254826 506 dbSNP
rs1185821634 512 dbSNP
rs1443284358 513 dbSNP
rs548469357 514 dbSNP
rs1199369340 516 dbSNP
rs1480697606 520 dbSNP
rs1252697540 528 dbSNP
rs566327601 531 dbSNP
rs930638338 533 dbSNP
rs183801801 539 dbSNP
rs907970504 542 dbSNP
rs1338576762 543 dbSNP
rs980259199 547 dbSNP
rs553890902 548 dbSNP
rs553027004 555 dbSNP
rs941647011 557 dbSNP
rs553541493 560 dbSNP
rs539138976 561 dbSNP
rs115112799 572 dbSNP
rs111230556 573 dbSNP
rs1183252959 578 dbSNP
rs889500883 585 dbSNP
rs1007043856 594 dbSNP
rs1043606834 596 dbSNP
rs904069235 613 dbSNP
rs749762529 622 dbSNP
rs999204972 625 dbSNP
rs1482500511 627 dbSNP
rs903666190 630 dbSNP
rs1224409626 634 dbSNP
rs1354040902 646 dbSNP
rs369353720 650 dbSNP
rs1031062165 651 dbSNP
rs999478161 654 dbSNP
rs955166662 655 dbSNP
rs575595341 656 dbSNP
rs1305235159 674 dbSNP
rs149127804 676 dbSNP
rs1390540134 677 dbSNP
rs963843094 678 dbSNP
rs74928555 679 dbSNP
rs1417088189 682 dbSNP
rs162118 707 dbSNP
rs1165377449 719 dbSNP
rs1026868385 720 dbSNP
rs1472005413 729 dbSNP
rs573460691 730 dbSNP
rs1024402350 733 dbSNP
rs1200633387 734 dbSNP
rs1449639044 735 dbSNP
rs1266334553 740 dbSNP
rs951349708 741 dbSNP
rs573806469 742 dbSNP
rs983484357 743 dbSNP
rs970199222 745 dbSNP
rs980589376 758 dbSNP
rs1266218551 768 dbSNP
rs746228500 770 dbSNP
rs910081934 771 dbSNP
rs963176812 779 dbSNP
rs144835826 789 dbSNP
rs374730225 789 dbSNP
rs560029942 789 dbSNP
rs992647834 789 dbSNP
rs374797688 792 dbSNP
rs1305771962 793 dbSNP
rs1319345896 794 dbSNP
rs162117 796 dbSNP
rs1387060765 800 dbSNP
rs575271461 802 dbSNP
rs933666826 804 dbSNP
rs1043879463 808 dbSNP
rs904124827 815 dbSNP
rs1476797045 822 dbSNP
rs1376742191 826 dbSNP
rs550660230 826 dbSNP
rs747115305 830 dbSNP
rs546018178 831 dbSNP
rs113465297 839 dbSNP
rs34564684 842 dbSNP
rs767328614 842 dbSNP
rs767541904 842 dbSNP
rs1008016274 847 dbSNP
rs760726218 850 dbSNP
rs1312653749 855 dbSNP
rs942488726 858 dbSNP
rs143239543 862 dbSNP
rs773030200 863 dbSNP
rs899558492 870 dbSNP
rs762894506 875 dbSNP
rs999741433 882 dbSNP
rs1354020642 889 dbSNP
rs1363545540 898 dbSNP
rs1052353108 901 dbSNP
rs1297489330 904 dbSNP
rs896368748 914 dbSNP
rs377748178 916 dbSNP
rs1408943514 926 dbSNP
rs1214624474 937 dbSNP
rs1335567363 945 dbSNP
rs11474278 946 dbSNP
rs2308248 946 dbSNP
rs1168209762 950 dbSNP
rs529742366 956 dbSNP
rs1484118084 960 dbSNP
rs112094304 961 dbSNP
rs1388031345 966 dbSNP
rs1187702363 969 dbSNP
rs548179022 975 dbSNP
rs566455867 977 dbSNP
rs766216997 978 dbSNP
rs148311564 980 dbSNP
rs865949070 981 dbSNP
rs916668349 988 dbSNP
rs1273969045 991 dbSNP
rs1203170672 995 dbSNP
rs1340316791 1004 dbSNP
rs1274279870 1009 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uaCAGGGUGGGG-GUGAGGACa 5'
            | || ::::|  ||||||| 
Target 5' caGGCCGGUUUCAAACUCCUG- 3'
 		2 - 22
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000601151.1 | 3UTR | CCAGGCCGGUUUCAAACUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
256 hsa-miR-4433a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088097 SEPT2 septin 2 2 2
MIRT143134 MGRN1 mahogunin ring finger 1 2 2
MIRT153912 NCOA3 nuclear receptor coactivator 3 2 2
MIRT154894 GNAS GNAS complex locus 2 4
MIRT200996 ZNF805 zinc finger protein 805 2 2
MIRT215729 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT235593 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT263250 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT317951 CDC5L cell division cycle 5 like 2 4
MIRT325572 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT354739 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT444552 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 4
MIRT446978 SUSD5 sushi domain containing 5 2 2
MIRT451036 ZNF610 zinc finger protein 610 2 2
MIRT451596 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT452025 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452594 CA6 carbonic anhydrase 6 2 2
MIRT452768 TCEA3 transcription elongation factor A3 2 4
MIRT452959 ZNF844 zinc finger protein 844 2 2
MIRT453191 ACSF2 acyl-CoA synthetase family member 2 2 2
MIRT453382 RHD Rh blood group D antigen 2 2
MIRT453685 CEBPD CCAAT/enhancer binding protein delta 2 2
MIRT455272 DDX39B DExD-box helicase 39B 2 8
MIRT455346 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT456494 SERAC1 serine active site containing 1 2 2
MIRT456585 NID1 nidogen 1 2 2
MIRT456888 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457123 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT457852 ZNF324B zinc finger protein 324B 2 2
MIRT457987 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT459278 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT459625 SLC25A33 solute carrier family 25 member 33 2 2
MIRT459715 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT460057 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460182 UNK unkempt family zinc finger 2 6
MIRT460288 PDE11A phosphodiesterase 11A 2 2
MIRT460841 EGF epidermal growth factor 2 4
MIRT460860 TBC1D19 TBC1 domain family member 19 2 2
MIRT461519 EMC7 ER membrane protein complex subunit 7 2 2
MIRT461729 SLC27A1 solute carrier family 27 member 1 2 4
MIRT461821 SNAP23 synaptosome associated protein 23 2 2
MIRT462066 CCDC77 coiled-coil domain containing 77 2 4
MIRT462084 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT462508 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 10
MIRT464239 VCP valosin containing protein 2 2
MIRT465316 TRAF5 TNF receptor associated factor 5 2 2
MIRT466549 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467128 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT468091 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT469630 RAD21 RAD21 cohesin complex component 2 6
MIRT471097 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472704 MYBL1 MYB proto-oncogene like 1 2 2
MIRT472830 MTMR10 myotubularin related protein 10 2 2
MIRT472872 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT472895 MTDH metadherin 2 2
MIRT473728 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT473859 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474047 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT474297 LAMC1 laminin subunit gamma 1 2 2
MIRT474658 KLF13 Kruppel like factor 13 2 2
MIRT475234 IKZF3 IKAROS family zinc finger 3 2 2
MIRT475500 HSP90B1 heat shock protein 90 beta family member 1 2 2
MIRT475742 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT475793 HDGF heparin binding growth factor 2 2
MIRT477254 ERGIC2 ERGIC and golgi 2 2 2
MIRT478228 DDX52 DExD-box helicase 52 2 2
MIRT478393 DCTN5 dynactin subunit 5 2 2
MIRT478754 CS citrate synthase 2 2
MIRT478827 CRKL CRK like proto-oncogene, adaptor protein 2 4
MIRT480234 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480597 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT484121 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT484689 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486331 C11orf54 chromosome 11 open reading frame 54 2 4
MIRT488599 FAM3C family with sequence similarity 3 member C 2 8
MIRT488833 MRRF mitochondrial ribosome recycling factor 2 2
MIRT492523 RAB15 RAB15, member RAS oncogene family 2 4
MIRT493632 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT500026 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501075 SMAD7 SMAD family member 7 2 8
MIRT503094 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503336 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT505465 STMN1 stathmin 1 2 4
MIRT505726 SERTAD3 SERTA domain containing 3 2 4
MIRT509333 MS4A4A membrane spanning 4-domains A4A 2 2
MIRT509978 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 4
MIRT513068 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT513446 EMP1 epithelial membrane protein 1 2 6
MIRT513736 PSD3 pleckstrin and Sec7 domain containing 3 2 4
MIRT513996 CENPQ centromere protein Q 2 4
MIRT516538 MIXL1 Mix paired-like homeobox 2 2
MIRT517606 SAV1 salvador family WW domain containing protein 1 2 2
MIRT518064 CEP89 centrosomal protein 89 2 2
MIRT518119 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT518325 WDR92 WD repeat domain 92 2 2
MIRT519048 ABCB11 ATP binding cassette subfamily B member 11 2 2
MIRT520972 SPPL2A signal peptide peptidase like 2A 2 4
MIRT521359 RPL35A ribosomal protein L35a 2 2
MIRT523359 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT523801 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT524622 C7orf73 short transmembrane mitochondrial protein 1 2 2
MIRT525550 PHB2 prohibitin 2 2 4
MIRT529709 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT531605 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT532387 UMPS uridine monophosphate synthetase 2 2
MIRT534468 SCD stearoyl-CoA desaturase 2 4
MIRT537546 ETNK1 ethanolamine kinase 1 2 2
MIRT541619 C11orf31 selenoprotein H 2 2
MIRT548380 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549523 HDDC2 HD domain containing 2 2 2
MIRT549774 SOD2 superoxide dismutase 2 2 2
MIRT550578 SLC2A5 solute carrier family 2 member 5 2 2
MIRT551498 CENPN centromere protein N 2 4
MIRT552301 ITGA3 integrin subunit alpha 3 2 2
MIRT555400 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT556399 LUC7L LUC7 like 2 2
MIRT557047 HOXB3 homeobox B3 2 2
MIRT558072 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 2
MIRT559659 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT561239 ZNF354B zinc finger protein 354B 2 2
MIRT566899 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT568786 FAM120B family with sequence similarity 120B 2 2
MIRT574014 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT574885 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 2
MIRT575243 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576194 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576309 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576484 Lhx4 LIM homeobox protein 4 2 3
MIRT576646 Mill2 MHC I like leukocyte 2 1 1
MIRT576708 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576855 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576950 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT617133 ZNF556 zinc finger protein 556 2 4
MIRT617928 ZNF783 zinc finger family member 783 2 2
MIRT618981 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT621100 SIX3 SIX homeobox 3 2 2
MIRT624537 BROX BRO1 domain and CAAX motif containing 2 2
MIRT625663 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT627059 DCTN6 dynactin subunit 6 2 2
MIRT628319 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT630859 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT632295 TMEM65 transmembrane protein 65 2 2
MIRT634115 ZNF207 zinc finger protein 207 2 2
MIRT634736 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT635655 NDST3 N-deacetylase and N-sulfotransferase 3 2 2
MIRT635772 PDCL3 phosducin like 3 2 2
MIRT635911 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT636365 OGFRL1 opioid growth factor receptor like 1 2 4
MIRT637251 GLRX2 glutaredoxin 2 2 2
MIRT638705 FZD4 frizzled class receptor 4 2 2
MIRT639640 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT639676 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT642267 SMIM17 small integral membrane protein 17 2 2
MIRT642372 ZNF581 zinc finger protein 581 2 2
MIRT643545 SLC25A17 solute carrier family 25 member 17 2 2
MIRT647994 PDE12 phosphodiesterase 12 2 2
MIRT649094 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT650993 ZNF770 zinc finger protein 770 2 2
MIRT651956 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT652977 SUN2 Sad1 and UNC84 domain containing 2 2 2
MIRT654389 RBM12B RNA binding motif protein 12B 2 2
MIRT655637 OLFML2A olfactomedin like 2A 2 2
MIRT655729 NRXN3 neurexin 3 2 2
MIRT658171 FCHSD1 FCH and double SH3 domains 1 2 2
MIRT660937 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662112 CERKL ceramide kinase like 2 2
MIRT662302 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT662993 TMEM59 transmembrane protein 59 2 2
MIRT663071 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663704 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663864 MUC20 mucin 20, cell surface associated 2 2
MIRT665185 HAUS5 HAUS augmin like complex subunit 5 2 4
MIRT665402 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665688 TNPO3 transportin 3 2 2
MIRT665795 TMEM170A transmembrane protein 170A 2 2
MIRT665847 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT666999 PDPN podoplanin 2 2
MIRT667598 LIPC lipase C, hepatic type 2 2
MIRT668576 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT670960 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT671187 ZNF891 zinc finger protein 891 2 2
MIRT671739 ZNF451 zinc finger protein 451 2 2
MIRT672745 ZNF585B zinc finger protein 585B 2 4
MIRT673446 ZNF583 zinc finger protein 583 2 2
MIRT679843 GPR75 G protein-coupled receptor 75 2 2
MIRT680556 ZNF584 zinc finger protein 584 2 2
MIRT680661 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT681285 RFC2 replication factor C subunit 2 2 2
MIRT683264 ZNF329 zinc finger protein 329 2 2
MIRT684519 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT685065 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685157 DTWD2 DTW domain containing 2 2 2
MIRT685168 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685470 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT686001 NEK4 NIMA related kinase 4 2 2
MIRT687027 RNF24 ring finger protein 24 2 2
MIRT687543 MOB1B MOB kinase activator 1B 2 2
MIRT687592 MANEAL mannosidase endo-alpha like 2 2
MIRT687753 KIAA1328 KIAA1328 2 2
MIRT688050 GLUL glutamate-ammonia ligase 2 2
MIRT688374 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT688802 CBFA2T3 CBFA2/RUNX1 translocation partner 3 2 2
MIRT688957 ATXN3 ataxin 3 2 2
MIRT689281 C5AR2 complement component 5a receptor 2 2 2
MIRT689988 NNMT nicotinamide N-methyltransferase 2 2
MIRT689997 MMP17 matrix metallopeptidase 17 2 2
MIRT690014 LUZP2 leucine zipper protein 2 2 2
MIRT690161 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690379 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT690563 MICA MHC class I polypeptide-related sequence A 2 2
MIRT691891 EVC EvC ciliary complex subunit 1 2 2
MIRT693107 SCNM1 sodium channel modifier 1 2 2
MIRT693832 ZFP64 ZFP64 zinc finger protein 2 2
MIRT694105 ZNF446 zinc finger protein 446 2 2
MIRT694179 ZNF486 zinc finger protein 486 2 2
MIRT694475 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT694998 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695031 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695163 TCTN2 tectonic family member 2 2 2
MIRT695525 SLC25A34 solute carrier family 25 member 34 2 2
MIRT696067 ZNF264 zinc finger protein 264 2 2
MIRT696616 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT696661 AGXT2 alanine--glyoxylate aminotransferase 2 2 2
MIRT696705 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT697173 INMT indolethylamine N-methyltransferase 2 2
MIRT697303 ZNF652 zinc finger protein 652 2 2
MIRT697491 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT698657 TERF2 telomeric repeat binding factor 2 2 2
MIRT699042 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699185 SLX4IP SLX4 interacting protein 2 2
MIRT699598 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT700150 RNF115 ring finger protein 115 2 2
MIRT700720 PNO1 partner of NOB1 homolog 2 2
MIRT700870 PER2 period circadian clock 2 2 2
MIRT700912 PDXK pyridoxal kinase 2 2
MIRT701095 PAPOLG poly(A) polymerase gamma 2 2
MIRT701194 OTUD3 OTU deubiquitinase 3 2 2
MIRT702203 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT702272 LHX4 LIM homeobox 4 2 3
MIRT703125 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT703252 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT703262 GNL3L G protein nucleolar 3 like 2 2
MIRT703440 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704321 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704393 CTSS cathepsin S 2 2
MIRT704483 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT704880 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT704926 CCDC36 coiled-coil domain containing 36 2 2
MIRT705175 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT706561 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT707048 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT711497 PGD phosphogluconate dehydrogenase 2 2
MIRT716644 EPGN epithelial mitogen 2 2
MIRT720083 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT722288 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT725468 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4433a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4433a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4433a Vincristine 5978 approved resistant cell line (W1)
hsa-mir-4433a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4433a-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4433a-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission