miRTarBase - #MIRT451170


—
pre-miRNA Information
pre-miRNA hsa-mir-4665   
Genomic Coordinates chr9: 6007826 - 6007904
Description Homo sapiens miR-4665 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4665-5p
Sequence 10| CUGGGGGACGCGUGAGCGCGAGC |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs901542342 1 dbSNP
rs1170299887 2 dbSNP
rs747546692 3 dbSNP
rs1260840238 4 dbSNP
rs1377576716 5 dbSNP
rs1349863083 6 dbSNP
rs933050749 7 dbSNP
rs1236802314 11 dbSNP
rs1050148325 12 dbSNP
rs1198393802 14 dbSNP
rs771241090 19 dbSNP
rs1258201615 20 dbSNP
rs1485839367 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PIN1   
Synonyms DOD, UBL5
Description peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Transcript NM_006221   
Expression
Putative miRNA Targets on PIN1
3'UTR of PIN1
(miRNA target sites are highlighted)		 
>PIN1|NM_006221|3'UTR
   1 GGGTGGGGAGCCCAGGCCTGGCCTCGGGGCAGGGCAGGGCGGCTAGGCCGGCCAGCTCCCCCTTGCCCGCCAGCCAGTGG
  81 CCGAACCCCCCACTCCCTGCCACCGTCACACAGTATTTATTGTTCCCACAATGGCTGGGAGGGGGCCCTTCCAGATTGGG
 161 GGCCCTGGGGTCCCCACTCCCTGTCCATCCCCAGTTGGGGCTGCGACCGCCAGATTCTCCCTTAAGGAATTGACTTCAGC
 241 AGGGGTGGGAGGCTCCCAGACCCAGGGCAGTGTGGTGGGAGGGGTGTTCCAAAGAGAAGGCCTGGTCAGCAGAGCCGCCC
 321 CGTGTCCCCCCAGGTGCTGGAGGCAGACTCGAGGGCCGAATTGTTTCTAGTTAGGCCACGCTCCTCTGTTCAGTCGCAAA
 401 GGTGAACACTCATGCGGCCCAGCCATGGGCCCTCTGAGCAACTGTGCAGCACCCTTTCACCCCCAATTAAACCCAGAACC
 481 ACTGCTCTGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgagcGCGAGUGCGCAGGGGGuc 5'
               ||| | ||:|||||||  
Target 5' agagcCGC-CCCGTGTCCCCCca 3'
 311 - 332 145.00 -26.40
2 
miRNA  3' cgagcGCGAGUGCGCAGGGGGuc 5'
               ||  || || ||||||  
Target 5' taggcCGGCCA-GC-TCCCCCtt 3'
 44 - 64 128.00 -20.00
3 
miRNA  3' cgagcgcgagugcgcaGGGGGUc 5'
                          |||||| 
Target 5' cagccagtggccgaacCCCCCAc 3'
 71 - 93 120.00 -17.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30149595 9 COSMIC
COSN17463032 37 COSMIC
COSN31592834 41 COSMIC
COSN30510358 43 COSMIC
COSN30510353 44 COSMIC
COSN31546083 57 COSMIC
COSN17462037 58 COSMIC
COSN28849911 146 COSMIC
COSN19668608 147 COSMIC
COSN24395119 194 COSMIC
COSN30561796 206 COSMIC
COSN31494569 206 COSMIC
COSN13846729 220 COSMIC
COSN30480469 278 COSMIC
COSN24804631 289 COSMIC
COSN30464648 305 COSMIC
COSN30145826 308 COSMIC
COSN26989103 317 COSMIC
COSN26989106 318 COSMIC
COSN26989107 322 COSMIC
COSN30541512 327 COSMIC
COSN30101087 330 COSMIC
COSN15619140 332 COSMIC
COSN30611916 341 COSMIC
COSN30541517 392 COSMIC
COSN30500687 394 COSMIC
COSN30663412 417 COSMIC
COSN26989104 418 COSMIC
COSN31492793 460 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766822401 3 dbSNP
rs774818838 4 dbSNP
rs1303592896 6 dbSNP
rs1385276404 8 dbSNP
rs1156641422 9 dbSNP
rs1454314296 11 dbSNP
rs1039131575 15 dbSNP
rs1438646354 25 dbSNP
rs757626665 25 dbSNP
rs759256615 26 dbSNP
rs373192122 27 dbSNP
rs781615417 27 dbSNP
rs1224314602 28 dbSNP
rs767021779 30 dbSNP
rs752256906 35 dbSNP
rs1254678131 36 dbSNP
rs1214478049 37 dbSNP
rs371600243 41 dbSNP
rs764075453 42 dbSNP
rs936144902 43 dbSNP
rs753753440 50 dbSNP
rs757081469 51 dbSNP
rs1242973168 56 dbSNP
rs889472890 58 dbSNP
rs1470780214 59 dbSNP
rs944433631 61 dbSNP
rs1406453042 62 dbSNP
rs778709813 63 dbSNP
rs531226317 69 dbSNP
rs34412035 70 dbSNP
rs1049424984 71 dbSNP
rs1334419226 78 dbSNP
rs1405037501 82 dbSNP
rs549785418 83 dbSNP
rs571445899 84 dbSNP
rs1047644228 87 dbSNP
rs773900738 88 dbSNP
rs1164706136 89 dbSNP
rs749845787 90 dbSNP
rs771519886 92 dbSNP
rs1325218525 94 dbSNP
rs1201429370 96 dbSNP
rs774871613 97 dbSNP
rs753585881 102 dbSNP
rs746328327 103 dbSNP
rs759755250 105 dbSNP
rs767268378 106 dbSNP
rs774993731 107 dbSNP
rs1211905582 110 dbSNP
rs760280318 111 dbSNP
rs763563070 113 dbSNP
rs753303893 116 dbSNP
rs1272578875 118 dbSNP
rs1175917844 120 dbSNP
rs894590850 130 dbSNP
rs757207853 140 dbSNP
rs765098800 141 dbSNP
rs1330724793 142 dbSNP
rs1446724851 143 dbSNP
rs750234439 145 dbSNP
rs758120498 147 dbSNP
rs768074795 151 dbSNP
rs1346801606 153 dbSNP
rs1276296167 155 dbSNP
rs781528786 157 dbSNP
rs1331512671 160 dbSNP
rs11540414 163 dbSNP
rs756366987 165 dbSNP
rs778024674 166 dbSNP
rs1271392007 168 dbSNP
rs1012992485 171 dbSNP
rs1223933436 177 dbSNP
rs1271713150 178 dbSNP
rs1466784743 180 dbSNP
rs1379799230 186 dbSNP
rs749324777 189 dbSNP
rs1198800745 194 dbSNP
rs532486600 195 dbSNP
rs753797738 196 dbSNP
rs746301950 198 dbSNP
rs1417179703 200 dbSNP
rs182032317 205 dbSNP
rs775248690 206 dbSNP
rs760349244 208 dbSNP
rs768247214 209 dbSNP
rs1322377292 210 dbSNP
rs1326636888 212 dbSNP
rs1320180685 213 dbSNP
rs1432517149 218 dbSNP
rs776129590 219 dbSNP
rs1033703799 220 dbSNP
rs1339090368 221 dbSNP
rs968745113 224 dbSNP
rs979130522 231 dbSNP
rs755119133 235 dbSNP
rs761244297 237 dbSNP
rs138973404 240 dbSNP
rs750312383 246 dbSNP
rs1434035336 247 dbSNP
rs1262577605 249 dbSNP
rs762849503 250 dbSNP
rs1191253629 258 dbSNP
rs766120927 262 dbSNP
rs751324758 266 dbSNP
rs779230821 271 dbSNP
rs778075661 272 dbSNP
rs1422728291 276 dbSNP
rs1397559612 277 dbSNP
rs754038335 279 dbSNP
rs757401994 280 dbSNP
rs779524466 283 dbSNP
rs746329101 284 dbSNP
rs780304222 285 dbSNP
rs536714595 287 dbSNP
rs1317680165 289 dbSNP
rs918942197 290 dbSNP
rs1381198362 295 dbSNP
rs372582123 301 dbSNP
rs761368897 303 dbSNP
rs769162158 305 dbSNP
rs554779527 308 dbSNP
rs1283745586 317 dbSNP
rs1461986007 318 dbSNP
rs762825388 319 dbSNP
rs1183953067 320 dbSNP
rs748347273 322 dbSNP
rs751405625 323 dbSNP
rs1210700660 326 dbSNP
rs1280723212 326 dbSNP
rs759401271 327 dbSNP
rs764470890 328 dbSNP
rs754091603 329 dbSNP
rs559703384 330 dbSNP
rs537029594 331 dbSNP
rs1470041727 332 dbSNP
rs758842131 333 dbSNP
rs920301824 335 dbSNP
rs778527530 350 dbSNP
rs780539909 351 dbSNP
rs781117286 352 dbSNP
rs1237739184 356 dbSNP
rs377091474 358 dbSNP
rs370315019 359 dbSNP
rs558957674 360 dbSNP
rs1205851718 365 dbSNP
rs748768881 367 dbSNP
rs1459772402 368 dbSNP
rs113254905 371 dbSNP
rs774417858 376 dbSNP
rs1441736734 377 dbSNP
rs1439554030 379 dbSNP
rs759454535 380 dbSNP
rs1239098283 381 dbSNP
rs368042262 381 dbSNP
rs1207994496 382 dbSNP
rs939231850 389 dbSNP
rs1480497152 390 dbSNP
rs1178087514 392 dbSNP
rs775383362 393 dbSNP
rs761961065 396 dbSNP
rs1299167866 397 dbSNP
rs765440978 398 dbSNP
rs750473383 405 dbSNP
rs758497573 408 dbSNP
rs766849847 410 dbSNP
rs1225451060 413 dbSNP
rs1464344959 414 dbSNP
rs1281542749 416 dbSNP
rs1350973123 416 dbSNP
rs541335704 417 dbSNP
rs1232246173 418 dbSNP
rs903258217 418 dbSNP
rs1251727374 419 dbSNP
rs1481557942 420 dbSNP
rs1202889850 424 dbSNP
rs755373011 427 dbSNP
rs781561941 430 dbSNP
rs1013456938 431 dbSNP
rs1413425594 432 dbSNP
rs553105039 437 dbSNP
rs1375406464 447 dbSNP
rs755729391 449 dbSNP
rs777477585 451 dbSNP
rs1171537163 452 dbSNP
rs748806899 459 dbSNP
rs770454642 461 dbSNP
rs774471250 463 dbSNP
rs745830137 464 dbSNP
rs1406843919 467 dbSNP
rs1185936244 468 dbSNP
rs775438484 475 dbSNP
rs1367148965 479 dbSNP
rs3178950 482 dbSNP
rs769551257 486 dbSNP
rs368303631 488 dbSNP
rs765441527 491 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgAGCGCGAGUGCGCAGGGGGUc 5'
            || | | : | | ||||||| 
Target 5' ccUCUCCCAUCCUCAUCCCCCAc 3'
 		9 - 31
2 
miRNA  3' cgagcgcgagugcgcaGGGGGuc 5'
                          ||| |  
Target 5' ----------------CCCGCuu 3'
 		1 - 7
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000593087.1 | 3UTR | CCCGCUUUCCUCUCCCAUCCUCAUCCCCCACACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
123 hsa-miR-4665-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT115350 IGF1R insulin like growth factor 1 receptor 2 8
MIRT144387 SF3B3 splicing factor 3b subunit 3 2 2
MIRT145421 ANKRD13B ankyrin repeat domain 13B 2 4
MIRT146684 MINK1 misshapen like kinase 1 2 2
MIRT178944 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT189772 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT238514 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT366308 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375173 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT442321 WNT9B Wnt family member 9B 2 2
MIRT442581 HOXD9 homeobox D9 2 2
MIRT451170 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 2 2
MIRT451894 ILK integrin linked kinase 2 2
MIRT453620 SLC4A2 solute carrier family 4 member 2 2 2
MIRT454769 STOML3 stomatin like 3 2 2
MIRT455038 MEN1 menin 1 2 2
MIRT455151 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT456891 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457201 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT457373 CAMK2A calcium/calmodulin dependent protein kinase II alpha 2 2
MIRT459190 RCE1 Ras converting CAAX endopeptidase 1 2 2
MIRT462580 MYL12A myosin light chain 12A 2 2
MIRT464669 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT464753 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT464881 UBALD1 UBA like domain containing 1 2 2
MIRT465932 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466013 TMEM189 transmembrane protein 189 2 2
MIRT466905 STK38 serine/threonine kinase 38 2 10
MIRT468421 SETD1B SET domain containing 1B 2 2
MIRT468592 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT468853 RREB1 ras responsive element binding protein 1 2 2
MIRT468900 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469189 RICTOR RPTOR independent companion of MTOR complex 2 2 2
MIRT469305 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469771 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469934 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT470000 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT470585 POTEM POTE ankyrin domain family member M 2 2
MIRT470615 POTEG POTE ankyrin domain family member G 2 2
MIRT470932 PKM pyruvate kinase, muscle 2 2
MIRT472511 NACC1 nucleus accumbens associated 1 2 2
MIRT472843 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT473298 MEX3A mex-3 RNA binding family member A 2 2
MIRT473951 LRRC58 leucine rich repeat containing 58 2 2
MIRT474336 KMT2D lysine methyltransferase 2D 2 2
MIRT474399 KLHL28 kelch like family member 28 2 8
MIRT476487 GATAD2A GATA zinc finger domain containing 2A 2 2
MIRT477597 EFNA3 ephrin A3 2 2
MIRT477857 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT479858 CCDC6 coiled-coil domain containing 6 2 2
MIRT480123 CALR calreticulin 2 2
MIRT480391 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480685 BRPF1 bromodomain and PHD finger containing 1 2 2
MIRT482326 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482513 ACTB actin beta 2 2
MIRT483244 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483282 SLC35C2 solute carrier family 35 member C2 2 4
MIRT483381 SPATA6 spermatogenesis associated 6 2 4
MIRT483416 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483468 STMN3 stathmin 3 2 4
MIRT484178 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484460 DDX6 DEAD-box helicase 6 2 2
MIRT484515 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT484595 SIX3 SIX homeobox 3 2 6
MIRT484738 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485248 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT485592 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485912 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT485954 RTBDN retbindin 2 2
MIRT486597 METTL6 methyltransferase like 6 2 2
MIRT486807 NDOR1 NADPH dependent diflavin oxidoreductase 1 2 2
MIRT486972 STEAP3 STEAP3 metalloreductase 2 4
MIRT487364 C10orf54 V-set immunoregulatory receptor 2 2
MIRT488072 DLGAP3 DLG associated protein 3 2 4
MIRT488150 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488454 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT489027 PRPF4B pre-mRNA processing factor 4B 2 2
MIRT489704 CALML3 calmodulin like 3 2 2
MIRT489757 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490015 PIEZO1 piezo type mechanosensitive ion channel component 1 2 2
MIRT490120 FN3K fructosamine 3 kinase 2 2
MIRT490187 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490313 ANK1 ankyrin 1 2 4
MIRT490595 SLC47A1 solute carrier family 47 member 1 2 4
MIRT491133 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT493027 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT494199 CLIP2 CAP-Gly domain containing linker protein 2 2 2
MIRT495699 PADI1 peptidyl arginine deiminase 1 2 2
MIRT501149 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501413 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501638 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT512047 DIRAS2 DIRAS family GTPase 2 2 4
MIRT519877 ZFP30 ZFP30 zinc finger protein 2 4
MIRT522598 MAP7D1 MAP7 domain containing 1 2 4
MIRT524787 BAG5 BCL2 associated athanogene 5 2 2
MIRT539158 AR androgen receptor 2 2
MIRT555901 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT562543 CCDC71L coiled-coil domain containing 71 like 2 4
MIRT568791 VPS37D VPS37D, ESCRT-I subunit 2 2
MIRT569568 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT570000 COL1A2 collagen type I alpha 2 chain 2 2
MIRT570183 RAP1GAP2 RAP1 GTPase activating protein 2 2 2
MIRT572990 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT574618 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT615354 CCNF cyclin F 2 2
MIRT616091 HOXB5 homeobox B5 2 2
MIRT617658 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT619107 CD40LG CD40 ligand 2 2
MIRT621198 ARPC1B actin related protein 2/3 complex subunit 1B 2 2
MIRT628839 FAM151B family with sequence similarity 151 member B 2 2
MIRT635552 LEPREL1 prolyl 3-hydroxylase 2 2 2
MIRT635703 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 2 2
MIRT646646 FNBP1 formin binding protein 1 2 2
MIRT654905 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 2 2
MIRT655121 PHF7 PHD finger protein 7 2 2
MIRT659457 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 4
MIRT668952 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT684242 TBXA2R thromboxane A2 receptor 2 2
MIRT692701 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT694328 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT712137 TAOK1 TAO kinase 1 2 2
MIRT713672 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT715741 HSD11B1L hydroxysteroid 11-beta dehydrogenase 1 like 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4665 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4665 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4665 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4665 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4665-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4665-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4665-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4665-5p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4665-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4665-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4665-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4665-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4665-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4665-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4665-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-4665-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4665-5p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4665-5p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4665-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission