miRTarBase - #MIRT451243


—
pre-miRNA Information
pre-miRNA hsa-mir-4271   
Genomic Coordinates chr3: 49274120 - 49274186
Description Homo sapiens miR-4271 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4271
Sequence 39| GGGGGAAGAAAAGGUGGGG |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30481495 1 COSMIC
COSN31532060 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760829741 1 dbSNP
rs1277951968 2 dbSNP
rs189148716 3 dbSNP
rs757021935 4 dbSNP
rs1285201145 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF444   
Synonyms EZF-2, EZF2, ZSCAN17
Description zinc finger protein 444
Transcript NM_018337   
Expression
Putative miRNA Targets on ZNF444
3'UTR of ZNF444
(miRNA target sites are highlighted)		 
>ZNF444|NM_018337|3'UTR
   1 CCGCCTCCCGGCCAGCGCCATCTCCCGCCCTTGGTGCTGCCCCCGGGCGGTACCTGCTCTCTCCCAGCGCCACTTGGCCT
  81 CTTCCTCTCCTCCTTCCCTCCCATCGTCCTCCTCCACCTGCGCCTCCCTTGTCTGAACTTCCCAACGCCTTCCTATTCCT
 161 TTCCAACTCCTTTTCCCCCAAATTTCACTTTCCTTCTCAGGTCTCACCTCAGCCCCCCCCTTCTCCCTGATTTCTCGGCC
 241 TCTCTCTCTGTGTGAAGGGGCCTCTCCCTAATGTCTCCTCCTTCCCCCCTCTTCTCTCTCCTGCGGCCCAGCCTCCCTCT
 321 CCCTCCTCCATTCCTCTCTCCCTGCCCTTTTCCTGCCTGAAGAGCAGAGGTGAGGACCTGGGACCCCTGAGGGGCAGGCC
 401 AGGAGGAGCTCGGGCGCAGGCCAGGCCCCCTTGGTGAAGCAGAGGCTGAAGGAAAGGGGTCTGGGTCTTGTCCCTAGGAA
 481 TTCTCCTCCCTCAGGAGATTGGGGGTTGGGGGAGGCAGCGGGTGATGGCTCTGAAGCTGAACCCAGGGCCTGGCTGTGGT
 561 CTTCTTGGTCTTGCTGCCCCCTGTGACCCAAAGGCATGGGATGGACAGAGATGCCTGCCCCCGTGAAGCTGGTTGGGGAG
 641 GGCAGTTCACCAGCATCCATAGAGTAATAAAGTCACTGTGTGTAGACCCGGAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            ||| ||  |:|||||| 
Target 5' ttCCAACTCCTTTTCCCCc 3'
 161 - 179 145.00 -20.30
2 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            :| ||  | ||||||| 
Target 5' tgTCTCC--TCCTTCCCCc 3'
 272 - 288 145.00 -19.90
3 
miRNA  3' ggGGUGGA--AAAGAAGGGGg 5'
            ||||:|    ||||||:| 
Target 5' cgCCACTTGGCCTCTTCCTCt 3'
 68 - 88 139.00 -19.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30528116 2 COSMIC
COSN7450328 99 COSMIC
COSN20079566 116 COSMIC
COSN22451842 206 COSMIC
COSN27493771 392 COSMIC
COSN29268706 510 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1252698746 3 dbSNP
rs1477964486 4 dbSNP
rs1179483175 5 dbSNP
rs1196264789 6 dbSNP
rs754707088 8 dbSNP
rs779115309 10 dbSNP
rs996350859 11 dbSNP
rs1197435811 12 dbSNP
rs748588681 14 dbSNP
rs1412822969 15 dbSNP
rs1029603173 17 dbSNP
rs538483363 18 dbSNP
rs370843874 24 dbSNP
rs1456848969 25 dbSNP
rs756663802 27 dbSNP
rs1324472545 28 dbSNP
rs552871613 30 dbSNP
rs747020703 31 dbSNP
rs770948744 32 dbSNP
rs1423534201 33 dbSNP
rs1208055861 35 dbSNP
rs1311833251 39 dbSNP
rs1279049064 40 dbSNP
rs1419777570 40 dbSNP
rs1386487802 41 dbSNP
rs1156801472 44 dbSNP
rs776867150 45 dbSNP
rs981895600 46 dbSNP
rs537440349 49 dbSNP
rs1428310127 50 dbSNP
rs937457690 55 dbSNP
rs991326139 59 dbSNP
rs750000280 62 dbSNP
rs1424581088 63 dbSNP
rs931197230 68 dbSNP
rs1203939437 69 dbSNP
rs1350630914 70 dbSNP
rs554560510 76 dbSNP
rs758088529 77 dbSNP
rs886732523 78 dbSNP
rs1333058717 86 dbSNP
rs60367783 87 dbSNP
rs777166885 87 dbSNP
rs1041141167 88 dbSNP
rs899566911 93 dbSNP
rs1315573178 96 dbSNP
rs1458489367 103 dbSNP
rs540945373 106 dbSNP
rs554039855 107 dbSNP
rs1166927928 110 dbSNP
rs978733634 112 dbSNP
rs1416884794 115 dbSNP
rs1164546599 118 dbSNP
rs922022272 119 dbSNP
rs778198743 120 dbSNP
rs10407167 123 dbSNP
rs890660779 128 dbSNP
rs1011750371 130 dbSNP
rs147321718 131 dbSNP
rs967644127 141 dbSNP
rs981460136 143 dbSNP
rs1036130857 146 dbSNP
rs1341075590 147 dbSNP
rs562967507 149 dbSNP
rs1221749459 151 dbSNP
rs186782645 157 dbSNP
rs1327912728 159 dbSNP
rs1438601330 160 dbSNP
rs1393515080 171 dbSNP
rs992003459 180 dbSNP
rs1026580232 182 dbSNP
rs1484881636 192 dbSNP
rs1206644460 193 dbSNP
rs919722115 194 dbSNP
rs905627986 196 dbSNP
rs1263582624 202 dbSNP
rs1001278441 209 dbSNP
rs558937136 213 dbSNP
rs931135403 213 dbSNP
rs960172989 213 dbSNP
rs189978566 215 dbSNP
rs908450030 217 dbSNP
rs182564045 218 dbSNP
rs79646647 219 dbSNP
rs373873984 220 dbSNP
rs1376185028 221 dbSNP
rs1429324663 221 dbSNP
rs920947180 222 dbSNP
rs1424456774 227 dbSNP
rs544730030 235 dbSNP
rs1178279647 238 dbSNP
rs1231510469 240 dbSNP
rs145803616 240 dbSNP
rs1471394676 240 dbSNP
rs575992555 240 dbSNP
rs1343913049 241 dbSNP
rs775918921 242 dbSNP
rs1045287106 244 dbSNP
rs1284951317 246 dbSNP
rs1278703158 247 dbSNP
rs905570941 247 dbSNP
rs377592024 249 dbSNP
rs1356361645 252 dbSNP
rs1314935790 255 dbSNP
rs1433013720 261 dbSNP
rs1358639999 262 dbSNP
rs274154 267 dbSNP
rs1402923219 268 dbSNP
rs1413326634 275 dbSNP
rs1011699415 279 dbSNP
rs895540870 282 dbSNP
rs1010496431 284 dbSNP
rs1185337325 284 dbSNP
rs1020079950 285 dbSNP
rs1217914158 287 dbSNP
rs968623331 287 dbSNP
rs1000155870 288 dbSNP
rs1233687325 289 dbSNP
rs1291052109 289 dbSNP
rs568571971 290 dbSNP
rs138024889 294 dbSNP
rs1305723387 295 dbSNP
rs1193983270 300 dbSNP
rs1314649882 301 dbSNP
rs953389298 302 dbSNP
rs1432921355 308 dbSNP
rs1286672165 312 dbSNP
rs1343965375 313 dbSNP
rs903434774 323 dbSNP
rs1158993321 347 dbSNP
rs1003561354 348 dbSNP
rs1035674050 354 dbSNP
rs987473023 361 dbSNP
rs958973485 382 dbSNP
rs1162406096 394 dbSNP
rs1208552576 394 dbSNP
rs1012961762 395 dbSNP
rs537552319 400 dbSNP
rs962125091 403 dbSNP
rs1187787028 410 dbSNP
rs8419 412 dbSNP
rs952805610 413 dbSNP
rs982597963 416 dbSNP
rs908397722 417 dbSNP
rs1232412519 421 dbSNP
rs1176867637 423 dbSNP
rs1321377799 427 dbSNP
rs761837788 428 dbSNP
rs1420968232 429 dbSNP
rs775197386 431 dbSNP
rs1045318630 432 dbSNP
rs1320538447 438 dbSNP
rs1046144 442 dbSNP
rs1397188227 444 dbSNP
rs937020402 446 dbSNP
rs1373301878 461 dbSNP
rs1056770067 466 dbSNP
rs533585375 473 dbSNP
rs932311839 474 dbSNP
rs1388991586 476 dbSNP
rs1053425074 479 dbSNP
rs540896098 483 dbSNP
rs914985094 484 dbSNP
rs1209039433 486 dbSNP
rs1480800811 491 dbSNP
rs904394173 494 dbSNP
rs1206869424 500 dbSNP
rs1448252830 502 dbSNP
rs1305883072 503 dbSNP
rs945158726 506 dbSNP
rs1000018935 508 dbSNP
rs760544971 510 dbSNP
rs903382530 515 dbSNP
rs1386568189 520 dbSNP
rs554423571 521 dbSNP
rs11268713 527 dbSNP
rs149503358 527 dbSNP
rs577658438 539 dbSNP
rs894763993 540 dbSNP
rs1309885808 541 dbSNP
rs1455152080 546 dbSNP
rs1393205435 548 dbSNP
rs1198078902 555 dbSNP
rs1419510510 557 dbSNP
rs1252373174 559 dbSNP
rs560753959 560 dbSNP
rs962442423 560 dbSNP
rs546409316 563 dbSNP
rs1046169 565 dbSNP
rs1211700245 577 dbSNP
rs1350059349 579 dbSNP
rs1282142696 580 dbSNP
rs1278895525 581 dbSNP
rs1013323428 588 dbSNP
rs1027682135 589 dbSNP
rs1309648762 591 dbSNP
rs1389982924 595 dbSNP
rs1027014250 603 dbSNP
rs1046170 609 dbSNP
rs1046174 611 dbSNP
rs749923882 615 dbSNP
rs1231399481 618 dbSNP
rs1481655854 620 dbSNP
rs1004317474 622 dbSNP
rs1373084614 623 dbSNP
rs74756334 624 dbSNP
rs965594798 634 dbSNP
rs1156691567 639 dbSNP
rs1453162583 643 dbSNP
rs1472108370 647 dbSNP
rs1176113501 653 dbSNP
rs1188918188 653 dbSNP
rs1426254634 657 dbSNP
rs1409767703 659 dbSNP
rs1169232926 661 dbSNP
rs1046180 663 dbSNP
rs1352473182 667 dbSNP
rs1448341709 670 dbSNP
rs1331483706 673 dbSNP
rs939583222 675 dbSNP
rs1262955717 677 dbSNP
rs576555651 679 dbSNP
rs1293594618 688 dbSNP
rs976657802 690 dbSNP
rs766005532 691 dbSNP
rs916959917 693 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            :| ||  | ||||||| 
Target 5' --UCUCC--UCCUUCCCCc 3'
 		1 - 15
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000592949.1 | 3UTR | UCUCCUCCUUCCCCCCUCUUCUCUCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
181 hsa-miR-4271 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066209 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT079367 CCDC137 coiled-coil domain containing 137 2 2
MIRT081183 MIDN midnolin 2 4
MIRT083278 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT086207 HOXD13 homeobox D13 2 2
MIRT133713 SKI SKI proto-oncogene 2 4
MIRT150653 SLC27A1 solute carrier family 27 member 1 2 2
MIRT159166 NRBP1 nuclear receptor binding protein 1 2 2
MIRT160059 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT180856 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT181931 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT190628 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190654 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT196107 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT263248 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT321168 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT338624 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT366301 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375172 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT441488 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT442333 WNT9B Wnt family member 9B 2 2
MIRT443889 CNKSR3 CNKSR family member 3 2 2
MIRT445880 WBP1L WW domain binding protein 1 like 2 2
MIRT449312 MRO maestro 2 2
MIRT449844 BCL2L13 BCL2 like 13 2 2
MIRT450304 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT450515 EMX1 empty spiracles homeobox 1 2 2
MIRT451243 ZNF444 zinc finger protein 444 2 2
MIRT451713 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451792 TLR5 toll like receptor 5 2 2
MIRT451823 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT451906 ILK integrin linked kinase 2 2
MIRT452181 KIAA1456 KIAA1456 2 4
MIRT452242 TRAM1 translocation associated membrane protein 1 2 2
MIRT452544 ZNF467 zinc finger protein 467 2 2
MIRT452605 REPIN1 replication initiator 1 2 2
MIRT454505 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT454657 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT455354 KDM5C lysine demethylase 5C 2 2
MIRT455452 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455587 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT456501 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT456815 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457425 NOL10 nucleolar protein 10 2 2
MIRT457468 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457660 SERINC1 serine incorporator 1 2 2
MIRT458231 NXPH3 neurexophilin 3 2 2
MIRT458374 ITM2C integral membrane protein 2C 2 2
MIRT458667 GPR35 G protein-coupled receptor 35 2 2
MIRT459665 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459825 TPP1 tripeptidyl peptidase 1 2 2
MIRT460564 FEM1A fem-1 homolog A 2 2
MIRT460725 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT461121 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461529 C14orf1 ergosterol biosynthesis 28 homolog 2 2
MIRT461750 DDX11 DEAD/H-box helicase 11 2 2
MIRT462570 STS steroid sulfatase 2 2
MIRT462798 NTN1 netrin 1 2 2
MIRT463030 ZNF689 zinc finger protein 689 2 2
MIRT463991 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT464684 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465439 TP53 tumor protein p53 2 2
MIRT465512 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465649 TNPO2 transportin 2 2 10
MIRT465947 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466028 TMEM189 transmembrane protein 189 2 2
MIRT468076 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT468131 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468498 SESN2 sestrin 2 2 2
MIRT468879 RREB1 ras responsive element binding protein 1 2 2
MIRT469318 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469558 RARA retinoic acid receptor alpha 2 2
MIRT469793 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469896 PTRF caveolae associated protein 1 2 2
MIRT470235 PRRC2A proline rich coiled-coil 2A 2 2
MIRT470808 PLXND1 plexin D1 2 2
MIRT471597 PAQR5 progestin and adipoQ receptor family member 5 2 10
MIRT471710 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT471752 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 2
MIRT472978 MRRF mitochondrial ribosome recycling factor 2 2
MIRT473538 MAX MYC associated factor X 2 2
MIRT473581 MAT2A methionine adenosyltransferase 2A 2 2
MIRT473970 LRRC58 leucine rich repeat containing 58 2 2
MIRT474223 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT474553 KLHDC3 kelch domain containing 3 2 2
MIRT474777 KIAA0895L KIAA0895 like 2 2
MIRT476042 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT476438 GBA2 glucosylceramidase beta 2 2 2
MIRT477773 E2F3 E2F transcription factor 3 2 4
MIRT477946 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478782 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT479320 VPS72 vacuolar protein sorting 72 homolog 2 2
MIRT480405 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480593 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT480963 BBC3 BCL2 binding component 3 2 2
MIRT481127 AZIN1 antizyme inhibitor 1 2 4
MIRT481444 ARRB2 arrestin beta 2 2 2
MIRT481687 AR androgen receptor 2 2
MIRT481730 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482386 AEN apoptosis enhancing nuclease 2 2
MIRT482564 ABHD2 abhydrolase domain containing 2 2 2
MIRT482605 ABHD14B abhydrolase domain containing 14B 2 2
MIRT483256 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483531 TAGLN2 transgelin 2 2 2
MIRT483840 UNC5B unc-5 netrin receptor B 2 4
MIRT483935 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484414 SNX19 sorting nexin 19 2 2
MIRT484487 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484609 SIX3 SIX homeobox 3 2 6
MIRT484703 RNF11 ring finger protein 11 2 2
MIRT485244 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT485607 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485965 RTBDN retbindin 2 2
MIRT487308 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT487329 SREBF1 sterol regulatory element binding transcription factor 1 2 4
MIRT487410 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487607 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487689 CDK14 cyclin dependent kinase 14 2 2
MIRT487787 GPR20 G protein-coupled receptor 20 2 4
MIRT488026 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT488476 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT488761 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489161 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489529 MRE11A MRE11 homolog, double strand break repair nuclease 2 8
MIRT489774 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489878 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT490094 FN3K fructosamine 3 kinase 2 2
MIRT490202 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490283 ISL2 ISL LIM homeobox 2 2 2
MIRT490377 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT491035 ALPK3 alpha kinase 3 2 2
MIRT491186 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491766 ZNF385A zinc finger protein 385A 2 2
MIRT491888 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT491981 UNK unkempt family zinc finger 2 2
MIRT492400 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT493647 HDLBP high density lipoprotein binding protein 2 2
MIRT494010 DUSP9 dual specificity phosphatase 9 2 2
MIRT494167 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT495712 PADI1 peptidyl arginine deiminase 1 2 2
MIRT496873 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT499175 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT501652 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT506645 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510590 TUBB2A tubulin beta 2A class IIa 2 6
MIRT511907 FKBP1A FK506 binding protein 1A 2 2
MIRT513063 ANKRD45 ankyrin repeat domain 45 2 2
MIRT513104 DYNAP dynactin associated protein 2 2
MIRT521804 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT523520 GLUL glutamate-ammonia ligase 2 2
MIRT525085 FRK fyn related Src family tyrosine kinase 2 2
MIRT530930 SCIN scinderin 2 2
MIRT533501 TRIM71 tripartite motif containing 71 2 2
MIRT538560 CECR2 CECR2, histone acetyl-lysine reader 2 2
MIRT544556 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT555912 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT560405 TMEM69 transmembrane protein 69 2 2
MIRT560664 RTN3 reticulon 3 2 2
MIRT564061 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT565504 SP1 Sp1 transcription factor 2 2
MIRT570014 COL1A2 collagen type I alpha 2 chain 2 2
MIRT572321 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT573229 TRIM21 tripartite motif containing 21 2 2
MIRT573487 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT574137 MARVELD1 MARVEL domain containing 1 2 2
MIRT574323 ZNF703 zinc finger protein 703 2 2
MIRT620939 OSMR oncostatin M receptor 2 2
MIRT650080 MTL5 testis expressed metallothionein like protein 2 2
MIRT684553 ZNF708 zinc finger protein 708 2 2
MIRT685841 ANGEL1 angel homolog 1 2 2
MIRT688551 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT701985 MIER3 MIER family member 3 2 2
MIRT703899 EPT1 selenoprotein I 2 2
MIRT706388 MC2R melanocortin 2 receptor 2 2
MIRT707487 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711885 INSIG2 insulin induced gene 2 2 2
MIRT719164 KIF6 kinesin family member 6 2 2
MIRT721294 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT721775 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT723763 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT725485 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4271 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-4271 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4271 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-4271 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-4271 Anlotinib 25017411 NSC832523 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Icotinib 22024915 NSC800770 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Erlotinib 176870 NSC718781 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-4271 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4271 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-4271 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4271 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4271 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission