>NDUFA11|NM_175614|3'UTR
   1 GCCCTGTGCCTGCCGGGACCTCCAGCCTGCAGAATGCGTCCAGAAATAAATTCTGTGTCTGTGTGTGTGTCAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ccugaGAUGUC-UGUGUGGa 5' ||:||| |::|::| Target 5' ccagcCTGCAGAATGCGTCc 3'	22 - 41	94.00	-10.80

Mutant ID	Mutant Position	Mutant Source
330235	55	ClinVar
330234	59	ClinVar
894131	63	ClinVar
COSN31784989	1	COSMIC
COSN26986182	5	COSMIC
COSN30646692	12	COSMIC
COSN508341	60	COSMIC
COSN30156544	64	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs766304743	1	dbSNP
rs763178359	3	dbSNP
rs750598527	9	dbSNP
rs1273668007	11	dbSNP
rs1206996306	12	dbSNP
rs765624733	14	dbSNP
rs762209658	15	dbSNP
rs776834428	20	dbSNP
rs955742240	26	dbSNP
rs1277796318	30	dbSNP
rs769260017	34	dbSNP
rs372606393	37	dbSNP
rs368932386	38	dbSNP
rs1433227753	46	dbSNP
rs1389824913	51	dbSNP
rs1375290940	53	dbSNP
rs771648754	55	dbSNP
rs765727153	56	dbSNP
rs191571307	59	dbSNP
rs770675936	60	dbSNP
rs779588327	61	dbSNP
rs1408789549	63	dbSNP
rs749166288	63	dbSNP
rs1469217273	67	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.