miRTarBase - #MIRT451455


—
pre-miRNA Information
pre-miRNA hsa-mir-4722   
Genomic Coordinates chr16: 88716278 - 88716337
Description Homo sapiens miR-4722 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4722-5p
Sequence 1| GGCAGGAGGGCUGUGCCAGGUUG |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1327113111 2 dbSNP
rs774516383 3 dbSNP
rs1353403500 6 dbSNP
rs768834483 11 dbSNP
rs938540081 13 dbSNP
rs557265812 14 dbSNP
rs1411163724 16 dbSNP
rs928486875 20 dbSNP
rs1172652034 21 dbSNP
rs942739465 23 dbSNP
Putative Targets

Gene Information
Gene Symbol HSD11B1L   
Synonyms 11-DH3, 11-beta-HSD3, HSD3, SCDR10, SCDR10B, SDR26C2
Description hydroxysteroid 11-beta dehydrogenase 1 like
Transcript NM_198705   
Other Transcripts NM_198704 , NM_198533 , NM_198706 , NM_198707 , NM_198708   
Expression
Putative miRNA Targets on HSD11B1L
3'UTR of HSD11B1L
(miRNA target sites are highlighted)		 
>HSD11B1L|NM_198705|3'UTR
   1 GCACCGGGGGGTGCCCCTCCAGTCCCAGACGGCAATGTTCCTCCCTCCAACTGTCCCTGGAGCCAGAACACTCACAGAGA
  81 CACCCCTGAGAGGGTGGCCACAGCCCAAGATGAAGTCATCAAGACAGAAAAGCAAAACCGAGAAAAACGACGGGCACCTG
 161 GAACCAGTCACGGCTTGGGAGGTGCAGGTGCCCCGTGTTAGGCGCCTTTGTCGGGGACTTGCAAGGCCTCACCTGTTTGG
 241 CCATGATTGATGACGTGACTGCTTCCATTTTGCAGATGAGGAAACTAAGGCTCAGAGAGGCCACGCCACCCTTGAGCCAC
 321 CCATGGACCCCTCTCCATCTCCTGCCTGCGCCTTTAAGTCCCTGATTTATTCTTTCCATTCATTCCATCTGGGAGGAACC
 401 CCCCCAACTCCTGCCAGCTTCCCCTAGCTGGGGTCTCTGGTACTCTTCACACCTGCAGGGGCGTCTACACTGTTCGTCTA
 481 CCTGGTGGCAGGGTCTGAGCGGGAGGAGGAGGGAAAGAGTGTGTTCTGAGCTGGACCCAGCCTCTTGTTCGAGAATAAAA
 561 ACTCTTCTTCTCTTGCAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guUGGACC------GUGUCGG--GAGGACGg 5'
            |:||||      | |  ||  ||||||| 
Target 5' ccATCTGGGAGGAACCCCCCCAACTCCTGCc 3'
 385 - 415 149.00 -23.90
2 
miRNA  3' guuGGACCGUGUCGGGAGGACGg 5'
             |||  | ||  :||||||| 
Target 5' accCCTCTC-CA--TCTCCTGCc 3'
 327 - 346 147.00 -18.30
3 
miRNA  3' guUGGACC-GUGUCGGGAGGACGg 5'
            | |||| | ||| ||||:||: 
Target 5' tgAGCTGGACCCAG-CCTCTTGTt 3'
 527 - 549 136.00 -20.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1210026 4 COSMIC
COSM8425401 9 COSMIC
COSM4614857 12 COSMIC
COSM6588683 20 COSMIC
COSM1395617 32 COSMIC
COSM4559164 97 COSMIC
COSM7708205 113 COSMIC
COSM4619494 162 COSMIC
COSM4615642 177 COSMIC
COSM393112 184 COSMIC
COSM4617996 195 COSMIC
COSM7591781 204 COSMIC
COSM7416927 211 COSMIC
COSM7295723 232 COSMIC
COSM4632816 242 COSMIC
COSN30592887 255 COSMIC
COSN20079509 311 COSMIC
COSN30176942 315 COSMIC
COSN30549241 346 COSMIC
COSN30632900 406 COSMIC
COSN14966313 468 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1354564384 2 dbSNP
rs762177710 4 dbSNP
rs1020004431 6 dbSNP
rs1323343683 6 dbSNP
rs1467553605 7 dbSNP
rs765805593 8 dbSNP
rs750688958 9 dbSNP
rs552868043 10 dbSNP
rs967546045 12 dbSNP
rs1222645552 14 dbSNP
rs1281550956 15 dbSNP
rs1349550824 16 dbSNP
rs1211117204 18 dbSNP
rs757885964 19 dbSNP
rs1000335820 20 dbSNP
rs940549564 21 dbSNP
rs201052217 22 dbSNP
rs1235048455 23 dbSNP
rs866790411 30 dbSNP
rs1470813497 31 dbSNP
rs544743697 32 dbSNP
rs368644338 33 dbSNP
rs781227352 36 dbSNP
rs1346755906 43 dbSNP
rs748278231 44 dbSNP
rs1156555700 45 dbSNP
rs1395883532 46 dbSNP
rs371623584 51 dbSNP
rs1412621896 52 dbSNP
rs1330649189 57 dbSNP
rs1024343750 58 dbSNP
rs1431496194 60 dbSNP
rs971803111 64 dbSNP
rs1045080688 66 dbSNP
rs1441427752 69 dbSNP
rs1205011010 70 dbSNP
rs1277743730 71 dbSNP
rs1253003069 72 dbSNP
rs1476520491 73 dbSNP
rs1372510344 77 dbSNP
rs373687274 80 dbSNP
rs1001098231 81 dbSNP
rs1279082814 82 dbSNP
rs1345314232 83 dbSNP
rs908601951 87 dbSNP
rs1052624677 94 dbSNP
rs748051957 97 dbSNP
rs1328846627 99 dbSNP
rs973189838 102 dbSNP
rs1480865346 103 dbSNP
rs868141486 105 dbSNP
rs1421823482 106 dbSNP
rs1438799313 113 dbSNP
rs1181699337 116 dbSNP
rs1008395880 117 dbSNP
rs1363936754 118 dbSNP
rs1236949054 119 dbSNP
rs1455636956 121 dbSNP
rs1171626779 127 dbSNP
rs771990238 129 dbSNP
rs367791868 132 dbSNP
rs1456841423 139 dbSNP
rs190801974 140 dbSNP
rs1169389497 141 dbSNP
rs1377152533 151 dbSNP
rs890129579 152 dbSNP
rs769857104 156 dbSNP
rs752423341 159 dbSNP
rs1326764918 161 dbSNP
rs1373103477 162 dbSNP
rs1486197105 163 dbSNP
rs768445779 165 dbSNP
rs1406293544 167 dbSNP
rs1302093037 168 dbSNP
rs1212588695 170 dbSNP
rs530306798 171 dbSNP
rs1368289051 173 dbSNP
rs1254929850 176 dbSNP
rs183044011 179 dbSNP
rs902910661 181 dbSNP
rs761394201 182 dbSNP
rs914366504 184 dbSNP
rs765607052 185 dbSNP
rs1470229815 186 dbSNP
rs1214341881 192 dbSNP
rs566920318 195 dbSNP
rs1431549573 196 dbSNP
rs763515779 198 dbSNP
rs1373912440 204 dbSNP
rs1033208052 211 dbSNP
rs1314421194 212 dbSNP
rs766695241 213 dbSNP
rs1168290381 215 dbSNP
rs1401717446 216 dbSNP
rs867764533 220 dbSNP
rs1220789666 222 dbSNP
rs1291073948 223 dbSNP
rs3760768 233 dbSNP
rs751966512 236 dbSNP
rs1260073165 240 dbSNP
rs1325187759 243 dbSNP
rs1490528674 246 dbSNP
rs1391628830 247 dbSNP
rs1383476493 248 dbSNP
rs1318566730 249 dbSNP
rs1325488801 250 dbSNP
rs1227072533 251 dbSNP
rs1276719849 252 dbSNP
rs1440372284 254 dbSNP
rs1337531010 255 dbSNP
rs1195930518 256 dbSNP
rs1234401643 256 dbSNP
rs1273161247 258 dbSNP
rs532663451 259 dbSNP
rs1255526482 263 dbSNP
rs1206979115 266 dbSNP
rs1485671193 267 dbSNP
rs1262623880 271 dbSNP
rs1187400571 274 dbSNP
rs1294938203 276 dbSNP
rs1446660848 281 dbSNP
rs1191190014 282 dbSNP
rs1024939759 287 dbSNP
rs1340149879 292 dbSNP
rs1475443019 294 dbSNP
rs1329777256 297 dbSNP
rs1164118498 300 dbSNP
rs1366720005 301 dbSNP
rs1415183523 305 dbSNP
rs1330697608 306 dbSNP
rs1462453202 310 dbSNP
rs948204653 317 dbSNP
rs552658327 322 dbSNP
rs982719401 329 dbSNP
rs1157099803 334 dbSNP
rs187571419 345 dbSNP
rs113160292 346 dbSNP
rs1472665078 348 dbSNP
rs769777076 350 dbSNP
rs1015652164 351 dbSNP
rs1235853302 360 dbSNP
rs866468973 382 dbSNP
rs936689565 386 dbSNP
rs962794469 387 dbSNP
rs1052344911 392 dbSNP
rs1355374756 399 dbSNP
rs892725086 399 dbSNP
rs569286407 400 dbSNP
rs1449983027 401 dbSNP
rs1041252737 404 dbSNP
rs920476262 405 dbSNP
rs899981180 409 dbSNP
rs75765597 418 dbSNP
rs1386150227 422 dbSNP
rs554997634 423 dbSNP
rs986071969 427 dbSNP
rs1160607951 436 dbSNP
rs911768900 453 dbSNP
rs1378064325 459 dbSNP
rs113690946 462 dbSNP
rs567576698 464 dbSNP
rs1454323270 467 dbSNP
rs1005893551 469 dbSNP
rs534011465 470 dbSNP
rs1014970783 476 dbSNP
rs962021601 477 dbSNP
rs1232838625 502 dbSNP
rs1285560198 509 dbSNP
rs11554339 510 dbSNP
rs1277785815 512 dbSNP
rs1443736311 519 dbSNP
rs902838306 531 dbSNP
rs1212740372 538 dbSNP
rs770771592 539 dbSNP
rs1436418906 552 dbSNP
rs1327491078 553 dbSNP
rs1320737908 562 dbSNP
rs1358299173 563 dbSNP
rs1418228846 563 dbSNP
rs374998691 573 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guuGGACCGUGUCGGGAGGACGg 5'
             |||  | ||  :||||||| 
Target 5' --cCCUCUC-CA--UCUCCUGCc 3'
 		1 - 18
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903829
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_a
Location of target site NM_198533 | 3UTR | CUCCUGCCAGCUUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903831
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / 124TD_shELAVL3_a
Location of target site NM_198533 | 3UTR | CUCCUGCCAGCUUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000581893.1 | 3UTR | CCCUCUCCAUCUCCUGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
451 hsa-miR-4722-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054597 SNCG synuclein gamma 3 1
MIRT082999 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT140189 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT143139 MGRN1 mahogunin ring finger 1 2 2
MIRT150114 MIDN midnolin 2 2
MIRT153929 NCOA3 nuclear receptor coactivator 3 2 2
MIRT200999 ZNF805 zinc finger protein 805 2 2
MIRT214002 DCP2 decapping mRNA 2 2 2
MIRT292480 ZNF507 zinc finger protein 507 2 2
MIRT325575 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT370125 TRIB3 tribbles pseudokinase 3 2 2
MIRT442143 C20orf197 chromosome 20 open reading frame 197 2 2
MIRT443495 MXI1 MAX interactor 1, dimerization protein 2 6
MIRT443526 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 2 4
MIRT445688 GJB1 gap junction protein beta 1 2 2
MIRT447187 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 4
MIRT448070 SLC25A43 solute carrier family 25 member 43 2 2
MIRT448198 B4GALT7 beta-1,4-galactosyltransferase 7 2 4
MIRT451251 ZNF444 zinc finger protein 444 2 2
MIRT451291 ZNF101 zinc finger protein 101 2 4
MIRT451455 HSD11B1L hydroxysteroid 11-beta dehydrogenase 1 like 2 2
MIRT451503 ALOX15 arachidonate 15-lipoxygenase 2 2
MIRT451752 LRTM2 leucine rich repeats and transmembrane domains 2 2 2
MIRT452056 ZNF585B zinc finger protein 585B 2 12
MIRT452211 HAVCR1 hepatitis A virus cellular receptor 1 2 8
MIRT452575 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452724 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 4
MIRT452736 PTGES3L prostaglandin E synthase 3 like 2 8
MIRT452760 TCEA3 transcription elongation factor A3 2 4
MIRT452868 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT452879 PRSS45 protease, serine 45 2 2
MIRT452967 ZNF844 zinc finger protein 844 2 8
MIRT453023 ZNF527 zinc finger protein 527 2 4
MIRT453060 TANGO2 transport and golgi organization 2 homolog 2 2
MIRT453480 PITPNM3 PITPNM family member 3 2 2
MIRT453706 TBX20 T-box 20 2 2
MIRT453904 GABRR2 gamma-aminobutyric acid type A receptor rho2 subunit 2 4
MIRT453967 ATP13A4 ATPase 13A4 2 6
MIRT454061 SLC35E3 solute carrier family 35 member E3 2 2
MIRT454246 CCDC125 coiled-coil domain containing 125 2 2
MIRT454481 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT454529 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454986 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT455482 NPY4R neuropeptide Y receptor Y4 2 2
MIRT455698 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT455929 HECTD3 HECT domain E3 ubiquitin protein ligase 3 2 2
MIRT456207 LIX1L limb and CNS expressed 1 like 2 6
MIRT456274 HRNR hornerin 2 2
MIRT456417 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT456732 TMEM239 transmembrane protein 239 2 2
MIRT456993 ZNF669 zinc finger protein 669 2 4
MIRT457132 ASPH aspartate beta-hydroxylase 2 2
MIRT457239 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457283 PCDHB11 protocadherin beta 11 2 2
MIRT457338 HSD3B7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 2 2
MIRT457471 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457542 ZC3H6 zinc finger CCCH-type containing 6 2 2
MIRT457640 ZNF69 zinc finger protein 69 2 2
MIRT457981 APAF1 apoptotic peptidase activating factor 1 2 4
MIRT458183 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT458453 RPRM reprimo, TP53 dependent G2 arrest mediator homolog 2 2
MIRT458461 SNX22 sorting nexin 22 2 6
MIRT458507 GSG2 histone H3 associated protein kinase 2 6
MIRT458557 C10orf71 chromosome 10 open reading frame 71 2 2
MIRT458637 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT458783 ZNF786 zinc finger protein 786 2 2
MIRT458795 CYP8B1 cytochrome P450 family 8 subfamily B member 1 2 2
MIRT459052 ZNF490 zinc finger protein 490 2 2
MIRT459398 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT459547 BTD biotinidase 2 4
MIRT460145 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460163 CCL16 C-C motif chemokine ligand 16 2 2
MIRT460243 IL17RB interleukin 17 receptor B 2 4
MIRT460356 TXNDC16 thioredoxin domain containing 16 2 4
MIRT460512 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT460613 FEM1A fem-1 homolog A 2 2
MIRT460713 FN3KRP fructosamine 3 kinase related protein 2 2
MIRT460799 VPS33A VPS33A, CORVET/HOPS core subunit 2 2
MIRT460829 EGF epidermal growth factor 2 4
MIRT460931 NOA1 nitric oxide associated 1 2 2
MIRT461113 PACSIN2 protein kinase C and casein kinase substrate in neurons 2 2 2
MIRT461124 RAB36 RAB36, member RAS oncogene family 2 4
MIRT461150 RAB2A RAB2A, member RAS oncogene family 2 2
MIRT461200 TIPIN TIMELESS interacting protein 2 2
MIRT461463 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461812 SNAP23 synaptosome associated protein 23 2 2
MIRT462078 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT462213 MLH1 mutL homolog 1 2 2
MIRT462308 TMEM109 transmembrane protein 109 2 2
MIRT462430 GTPBP10 GTP binding protein 10 2 4
MIRT462503 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 8
MIRT462535 PLLP plasmolipin 2 6
MIRT462691 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT462908 ZNRF3 zinc and ring finger 3 2 2
MIRT462964 ZNF788 zinc finger family member 788 2 2
MIRT463066 ZNF639 zinc finger protein 639 2 4
MIRT463868 WNT7B Wnt family member 7B 2 2
MIRT464036 WASL Wiskott-Aldrich syndrome like 2 2
MIRT464115 VPS35 VPS35, retromer complex component 2 2
MIRT464507 UCK2 uridine-cytidine kinase 2 2 2
MIRT464931 TXLNA taxilin alpha 2 2
MIRT465203 TRMT6 tRNA methyltransferase 6 2 2
MIRT465579 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT466090 TMEM184C transmembrane protein 184C 2 2
MIRT466208 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT467010 SSBP2 single stranded DNA binding protein 2 2 4
MIRT467159 SREBF2 sterol regulatory element binding transcription factor 2 2 2
MIRT467754 SLC35F1 solute carrier family 35 member F1 2 4
MIRT467843 SLC25A34 solute carrier family 25 member 34 2 2
MIRT468139 SH3BP4 SH3 domain binding protein 4 2 2
MIRT469034 RNF38 ring finger protein 38 2 6
MIRT469062 RNF20 ring finger protein 20 2 2
MIRT469280 RHOA ras homolog family member A 2 2
MIRT469584 RAP2B RAP2B, member of RAS oncogene family 2 6
MIRT470108 PTBP2 polypyrimidine tract binding protein 2 2 6
MIRT470186 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT470282 PRDX5 peroxiredoxin 5 2 2
MIRT471059 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 2 2
MIRT471160 PHF12 PHD finger protein 12 2 2
MIRT471337 PERP PERP, TP53 apoptosis effector 2 2
MIRT471573 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT471643 PANK2 pantothenate kinase 2 2 4
MIRT472028 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT472319 NF2 neurofibromin 2 2 2
MIRT472821 MTMR10 myotubularin related protein 10 2 4
MIRT473101 MLXIP MLX interacting protein 2 2
MIRT473292 MFRP membrane frizzled-related protein 2 2
MIRT473635 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474108 LMBR1L limb development membrane protein 1 like 2 2
MIRT474615 KLF2 Kruppel like factor 2 2 4
MIRT474666 KLF13 Kruppel like factor 13 2 4
MIRT474696 KIF5A kinesin family member 5A 2 2
MIRT474818 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475280 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475650 HIF3A hypoxia inducible factor 3 alpha subunit 2 4
MIRT475703 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475762 HDLBP high density lipoprotein binding protein 2 2
MIRT476382 GID4 GID complex subunit 4 homolog 2 4
MIRT476398 GDE1 glycerophosphodiester phosphodiesterase 1 2 8
MIRT476446 GBA2 glucosylceramidase beta 2 2 2
MIRT476804 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT477074 FAM208A family with sequence similarity 208 member A 2 4
MIRT477152 FADS1 fatty acid desaturase 1 2 8
MIRT477247 ERGIC2 ERGIC and golgi 2 2 2
MIRT477543 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT478088 DLGAP4 DLG associated protein 4 2 2
MIRT478226 DDX52 DExD-box helicase 52 2 2
MIRT478751 CS citrate synthase 2 2
MIRT479196 CLCN5 chloride voltage-gated channel 5 2 6
MIRT479908 CCDC117 coiled-coil domain containing 117 2 6
MIRT480198 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 2 2
MIRT480437 C17orf49 chromosome 17 open reading frame 49 2 2
MIRT480722 BPTF bromodomain PHD finger transcription factor 2 4
MIRT481096 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT481429 ASB6 ankyrin repeat and SOCS box containing 6 2 4
MIRT482080 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT482256 AGO3 argonaute 3, RISC catalytic component 2 4
MIRT482342 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482463 ADAR adenosine deaminase, RNA specific 2 4
MIRT483780 CASKIN1 CASK interacting protein 1 2 4
MIRT484384 ZNF710 zinc finger protein 710 2 4
MIRT485110 SHISA6 shisa family member 6 2 2
MIRT487430 ZSCAN25 zinc finger and SCAN domain containing 25 2 4
MIRT487519 GXYLT2 glucoside xylosyltransferase 2 2 4
MIRT487911 FBXO44 F-box protein 44 2 2
MIRT487961 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT488496 SFMBT2 Scm like with four mbt domains 2 2 4
MIRT488595 SPN sialophorin 2 2
MIRT488994 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT490265 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT490835 ADD2 adducin 2 2 2
MIRT490863 UPK2 uroplakin 2 2 2
MIRT491481 APC2 APC2, WNT signaling pathway regulator 2 6
MIRT491713 C17orf85 nuclear cap binding subunit 3 2 2
MIRT492571 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 4
MIRT495792 GRK1 G protein-coupled receptor kinase 1 2 4
MIRT496285 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT496791 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT498599 KRT8 keratin 8 2 2
MIRT498734 SNTN sentan, cilia apical structure protein 2 6
MIRT500016 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501616 PISD phosphatidylserine decarboxylase 2 2
MIRT502160 KIAA1109 KIAA1109 2 4
MIRT502319 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT503238 C16orf74 chromosome 16 open reading frame 74 2 4
MIRT503427 SLC25A45 solute carrier family 25 member 45 2 6
MIRT503871 CBS cystathionine-beta-synthase 2 2
MIRT505181 USP46 ubiquitin specific peptidase 46 2 4
MIRT505402 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 4
MIRT507338 FAM168A family with sequence similarity 168 member A 2 2
MIRT508899 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT516506 SYTL3 synaptotagmin like 3 2 4
MIRT516528 MIXL1 Mix paired-like homeobox 2 2
MIRT517214 PRIM1 DNA primase subunit 1 2 4
MIRT517972 DSCR3 DSCR3 arrestin fold containing 2 2
MIRT518902 CDC14B cell division cycle 14B 2 2
MIRT519272 ZNF141 zinc finger protein 141 2 4
MIRT520332 UBXN2A UBX domain protein 2A 2 2
MIRT524620 C7orf73 short transmembrane mitochondrial protein 1 2 2
MIRT525322 SNX29 sorting nexin 29 2 2
MIRT529045 CDK18 cyclin dependent kinase 18 2 2
MIRT533852 TEAD1 TEA domain transcription factor 1 2 2
MIRT536401 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT546465 SLC25A44 solute carrier family 25 member 44 2 2
MIRT548657 CTTNBP2NL CTTNBP2 N-terminal like 2 2
MIRT549906 ADH4 alcohol dehydrogenase 4 (class II), pi polypeptide 2 2
MIRT550418 ORC4 origin recognition complex subunit 4 2 2
MIRT550571 SLC2A5 solute carrier family 2 member 5 2 2
MIRT550592 CBY3 chibby family member 3 2 2
MIRT550771 ENOX2 ecto-NOX disulfide-thiol exchanger 2 2 4
MIRT550988 RBM38 RNA binding motif protein 38 2 2
MIRT551332 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT551393 MRI1 methylthioribose-1-phosphate isomerase 1 2 4
MIRT553919 STK11IP serine/threonine kinase 11 interacting protein 2 2
MIRT554616 RPS6KA3 ribosomal protein S6 kinase A3 2 2
MIRT559202 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT559537 ARHGAP1 Rho GTPase activating protein 1 2 2
MIRT559650 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT560141 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT562318 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT564496 PUS3 pseudouridylate synthase 3 2 2
MIRT566253 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT567619 FAM210A family with sequence similarity 210 member A 2 2
MIRT567950 CREBZF CREB/ATF bZIP transcription factor 2 2
MIRT568011 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT574884 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 2
MIRT575559 Cd99 CD99 antigen 2 2
MIRT576147 Hmox1 heme oxygenase 1 2 2
MIRT608269 NOP14 NOP14 nucleolar protein 2 2
MIRT610850 ARSA arylsulfatase A 2 2
MIRT614128 THAP1 THAP domain containing 1 2 6
MIRT614722 TEAD3 TEA domain transcription factor 3 2 2
MIRT615227 BROX BRO1 domain and CAAX motif containing 2 2
MIRT617419 ANP32E acidic nuclear phosphoprotein 32 family member E 2 4
MIRT618170 ZNF681 zinc finger protein 681 2 4
MIRT618873 MBL2 mannose binding lectin 2 2 2
MIRT618974 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT619184 SLC16A4 solute carrier family 16 member 4 2 2
MIRT620310 AQP6 aquaporin 6 2 2
MIRT620422 CD3EAP CD3e molecule associated protein 2 2
MIRT620451 CENPN centromere protein N 2 2
MIRT621649 UBXN2B UBX domain protein 2B 2 2
MIRT621951 STX7 syntaxin 7 2 2
MIRT622815 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 4
MIRT623357 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT624916 FBXW2 F-box and WD repeat domain containing 2 2 2
MIRT624979 ZNF665 zinc finger protein 665 2 4
MIRT625490 SMAD9 SMAD family member 9 2 2
MIRT625587 KLHL23 kelch like family member 23 2 2
MIRT625656 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT625879 INADL PATJ, crumbs cell polarity complex component 2 2
MIRT626231 ZNF749 zinc finger protein 749 2 2
MIRT626621 SLC30A6 solute carrier family 30 member 6 2 2
MIRT626986 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT627055 DCTN6 dynactin subunit 6 2 2
MIRT627674 RPL28 ribosomal protein L28 2 2
MIRT627887 OLFML2A olfactomedin like 2A 2 2
MIRT627981 NDRG3 NDRG family member 3 2 2
MIRT628313 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT628343 CCDC68 coiled-coil domain containing 68 2 2
MIRT631946 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 4
MIRT632270 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT636356 OGFRL1 opioid growth factor receptor like 1 2 2
MIRT639187 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT639668 PPEF2 protein phosphatase with EF-hand domain 2 2 6
MIRT639865 STK40 serine/threonine kinase 40 2 2
MIRT642230 RABAC1 Rab acceptor 1 2 2
MIRT642364 ZNF581 zinc finger protein 581 2 2
MIRT646793 EVC2 EvC ciliary complex subunit 2 2 2
MIRT646977 KCNJ11 potassium voltage-gated channel subfamily J member 11 2 2
MIRT647068 BRIX1 BRX1, biogenesis of ribosomes 2 4
MIRT647310 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT648993 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT649132 SPATA5 spermatogenesis associated 5 2 2
MIRT650524 CCDC77 coiled-coil domain containing 77 2 4
MIRT650986 ZNF770 zinc finger protein 770 2 2
MIRT655721 NRXN3 neurexin 3 2 2
MIRT657564 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT659811 CASP16 caspase 16, pseudogene 2 2
MIRT660471 ARSK arylsulfatase family member K 2 2
MIRT661131 ZNF43 zinc finger protein 43 2 2
MIRT661193 MPPE1 metallophosphoesterase 1 2 2
MIRT661429 MANSC1 MANSC domain containing 1 2 2
MIRT661545 ZNF674 zinc finger protein 674 2 4
MIRT661669 ZNF623 zinc finger protein 623 2 2
MIRT661800 NUP85 nucleoporin 85 2 2
MIRT661853 ZNF766 zinc finger protein 766 2 2
MIRT662133 ZC3H8 zinc finger CCCH-type containing 8 2 2
MIRT662285 SLC29A4 solute carrier family 29 member 4 2 2
MIRT662705 C10orf111 chromosome 10 open reading frame 111 2 4
MIRT662823 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT662880 PCDHA6 protocadherin alpha 6 2 2
MIRT662999 TMEM59 transmembrane protein 59 2 2
MIRT663236 MPHOSPH8 M-phase phosphoprotein 8 2 2
MIRT663423 ZNF607 zinc finger protein 607 2 2
MIRT663696 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663832 AGBL5 ATP/GTP binding protein like 5 2 4
MIRT663858 MUC20 mucin 20, cell surface associated 2 2
MIRT664258 NMUR1 neuromedin U receptor 1 2 2
MIRT664842 HUS1 HUS1 checkpoint clamp component 2 2
MIRT664881 PRRG4 proline rich and Gla domain 4 2 2
MIRT664937 CARD6 caspase recruitment domain family member 6 2 4
MIRT665505 UTP15 UTP15, small subunit processome component 2 2
MIRT665640 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT665658 TRAF1 TNF receptor associated factor 1 2 2
MIRT665681 TNPO3 transportin 3 2 2
MIRT665934 TBC1D19 TBC1 domain family member 19 2 4
MIRT665995 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT666164 SNX27 sorting nexin family member 27 2 4
MIRT666364 SHOX short stature homeobox 2 2
MIRT666991 PDPN podoplanin 2 4
MIRT667179 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT667594 LIPC lipase C, hepatic type 2 2
MIRT667818 IRGQ immunity related GTPase Q 2 2
MIRT667845 IPCEF1 interaction protein for cytohesin exchange factors 1 2 2
MIRT668571 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT669096 CDK19 cyclin dependent kinase 19 2 2
MIRT670062 ZNF783 zinc finger family member 783 2 2
MIRT670954 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT671180 ZNF891 zinc finger protein 891 2 2
MIRT673440 ZNF583 zinc finger protein 583 2 2
MIRT673941 ZNF500 zinc finger protein 500 2 2
MIRT674159 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT674200 FUT2 fucosyltransferase 2 2 2
MIRT674677 PLCE1 phospholipase C epsilon 1 2 2
MIRT675232 MAK male germ cell associated kinase 2 2
MIRT676003 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT679836 GPR75 G protein-coupled receptor 75 2 2
MIRT680570 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT680750 PSD4 pleckstrin and Sec7 domain containing 4 2 2
MIRT680957 SLC15A1 solute carrier family 15 member 1 2 4
MIRT681201 ZNF638 zinc finger protein 638 2 2
MIRT681421 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT681590 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT682026 AGXT2 alanine--glyoxylate aminotransferase 2 2 4
MIRT682340 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 4
MIRT682657 CASP8 caspase 8 2 2
MIRT682980 ABCA2 ATP binding cassette subfamily A member 2 2 2
MIRT683272 ZNF99 zinc finger protein 99 2 2
MIRT683349 SCARF1 scavenger receptor class F member 1 2 2
MIRT683447 ACOT2 acyl-CoA thioesterase 2 2 2
MIRT683586 GSTCD glutathione S-transferase C-terminal domain containing 2 2
MIRT683654 ZNF695 zinc finger protein 695 2 2
MIRT683733 EIF3L eukaryotic translation initiation factor 3 subunit L 2 2
MIRT683762 CPE carboxypeptidase E 2 2
MIRT683797 NOTO notochord homeobox 2 2
MIRT684453 MFSD4 major facilitator superfamily domain containing 4A 2 2
MIRT684510 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT684979 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT685003 CXorf56 chromosome X open reading frame 56 2 2
MIRT685106 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 2 2
MIRT685123 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT685463 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT686021 UMPS uridine monophosphate synthetase 2 2
MIRT686551 TPM3 tropomyosin 3 2 2
MIRT686869 SLC25A32 solute carrier family 25 member 32 2 2
MIRT686962 SFT2D2 SFT2 domain containing 2 2 2
MIRT687278 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT688075 GLUL glutamate-ammonia ligase 2 2
MIRT688158 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT688574 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT688591 CYCS cytochrome c, somatic 2 2
MIRT689274 C5AR2 complement component 5a receptor 2 2 2
MIRT689427 CYB561 cytochrome b561 2 2
MIRT690043 C6orf141 chromosome 6 open reading frame 141 2 2
MIRT690214 C5orf45 MRN complex interacting protein 2 2
MIRT690259 CAMLG calcium modulating ligand 2 2
MIRT690319 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT690358 RPL37A ribosomal protein L37a 2 2
MIRT690519 ZNF566 zinc finger protein 566 2 2
MIRT690572 MICA MHC class I polypeptide-related sequence A 2 2
MIRT690707 WDR73 WD repeat domain 73 2 2
MIRT690862 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT691150 APOL6 apolipoprotein L6 2 2
MIRT691279 CENPM centromere protein M 2 2
MIRT691754 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 2 2
MIRT691762 BCL2L15 BCL2 like 15 2 2
MIRT691775 SLC24A4 solute carrier family 24 member 4 2 2
MIRT692038 PAK1IP1 PAK1 interacting protein 1 2 2
MIRT692185 POLR1E RNA polymerase I subunit E 2 2
MIRT692756 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 2 2
MIRT692847 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT693064 AS3MT arsenite methyltransferase 2 2
MIRT693114 SCNM1 sodium channel modifier 1 2 2
MIRT693173 NPR1 natriuretic peptide receptor 1 2 2
MIRT693499 MOB3A MOB kinase activator 3A 2 2
MIRT693682 MXRA7 matrix remodeling associated 7 2 2
MIRT694066 RNASEH2B ribonuclease H2 subunit B 2 2
MIRT694154 SLC36A2 solute carrier family 36 member 2 2 2
MIRT694251 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT694545 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 2 2
MIRT694770 BVES blood vessel epicardial substance 2 2
MIRT695037 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695265 CD209 CD209 molecule 2 2
MIRT695427 TCF23 transcription factor 23 2 2
MIRT695564 ZNF562 zinc finger protein 562 2 2
MIRT696357 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT696523 C3 complement C3 2 2
MIRT696611 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT696768 DHODH dihydroorotate dehydrogenase (quinone) 2 2
MIRT697066 PSMC4 proteasome 26S subunit, ATPase 4 2 2
MIRT697097 GPKOW G-patch domain and KOW motifs 2 2
MIRT697481 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT697622 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT697904 RPS27A ribosomal protein S27a 2 2
MIRT697956 TSPYL1 TSPY like 1 2 2
MIRT698366 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT698403 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT698631 TES testin LIM domain protein 2 2
MIRT698963 SPAST spastin 2 2
MIRT699035 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699485 SLC10A6 solute carrier family 10 member 6 2 2
MIRT699579 SIKE1 suppressor of IKBKE 1 2 2
MIRT699594 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT699830 SCD stearoyl-CoA desaturase 2 2
MIRT700426 QDPR quinoid dihydropteridine reductase 2 2
MIRT700469 PURB purine rich element binding protein B 2 2
MIRT700863 PER2 period circadian clock 2 2 2
MIRT700943 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT701161 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT701417 NHLRC2 NHL repeat containing 2 2 2
MIRT701468 NEK9 NIMA related kinase 9 2 2
MIRT701655 MYH9 myosin heavy chain 9 2 2
MIRT701693 MYADM myeloid associated differentiation marker 2 2
MIRT701769 MSL2 MSL complex subunit 2 2 2
MIRT701788 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT702784 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT703120 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT703248 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT703265 GNL3L G protein nucleolar 3 like 2 2
MIRT703326 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 2 2
MIRT703648 FAM60A SIN3-HDAC complex associated factor 2 2
MIRT703753 FAM118A family with sequence similarity 118 member A 2 2
MIRT703854 ERN1 endoplasmic reticulum to nucleus signaling 1 2 2
MIRT704315 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704800 CDC73 cell division cycle 73 2 2
MIRT704941 CCDC120 coiled-coil domain containing 120 2 2
MIRT704975 CAV1 caveolin 1 2 2
MIRT705613 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 2
MIRT705672 ANKRD40 ankyrin repeat domain 40 2 2
MIRT706160 TFDP2 transcription factor Dp-2 2 2
MIRT706229 SYT15 synaptotagmin 15 2 2
MIRT706457 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT706555 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT707158 SMIM19 small integral membrane protein 19 2 2
MIRT710604 ZNF555 zinc finger protein 555 2 2
MIRT711709 IREB2 iron responsive element binding protein 2 2 2
MIRT711859 TRAF2 TNF receptor associated factor 2 2 2
MIRT713155 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT717108 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT721309 FAM58A cyclin Q 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4722 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4722 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4722 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4722-5p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4722-5p Paclitaxel 36314 NSC125973 approved resistant High Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-4722-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4722-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4722-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission