pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-2110 |
Genomic Coordinates | chr10: 114174105 - 114174179 |
Synonyms | hsa-mir-2110, MIR2110 |
Description | Homo sapiens miR-2110 stem-loop |
Comment | Zhu et al. incorrectly referred to this sequence as mir-1309 in . This sequence is unrelated to MIR1309 in plants. |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-2110 | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 8| UUGGGGAAACGGCCGCUGAGUG |29 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | 454 | DRVs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CIAPIN1 | ||||||||||||||||||||
Synonyms | Anamorsin, DRE2, PRO0915 | ||||||||||||||||||||
Description | cytokine induced apoptosis inhibitor 1 | ||||||||||||||||||||
Transcript | NM_020313 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CIAPIN1 | |||||||||||||||||||||
3'UTR of CIAPIN1 (miRNA target sites are highlighted) |
>CIAPIN1|NM_020313|3'UTR 1 GAGGTTCCTGACATGGGACCCATCTGCTCCTCCAGCCAACTCCTGTCCCTCACATCCCACCATGGTGGCTCCTCCCACCT 81 CCTCTGGATTTGTTCACTCTGAGATCTGTTTGCAGAGTGGGTGCTTAGCAGACAGAGTGAAGCTGGCTGGGGGGCACAGT 161 GGTGTGTAGTGCTGCTGTGTATCAAAAGACCAAGGTATTATGGGACCTGGTTTCAGAATGGGATGGGTTTCTTCACCTCA 241 TGTTAAGAGAAGGGAGTGTGTCCTGAAGAAGCCCTTCTTCTGATGTTAAAATGCTGACCAGAACGCTCTTGAGCCCAGGC 321 ATCGTTGAGCATTAACACTCTGTGACAGAGCTGCAGACCCCTGCCTTGAGTCTCATCTCAGCAATGCTGCCACCCTCTTG 401 TCTTTCAGAGTTGTTAGTTTACTCCATTCTTTGTGACACGAGTCAAGTGGCTCACAACCTCCTCAGGGCACCAGAGGACT 481 CACTCACTGGTTGCTGTGATGATATCCAGTGTCCCTCTGCCCCCTTCCATCCCCAACCACATTTGACTGTAGCATTGCAT 561 CTGTGTCCTGTTGTCATTTATGTTAACCTTCAGGTATTAAACTTGCTGCATATCTTGACATATCTTGAGATTCTGCATGT 641 CTTGTAAAGAGAGGGGATGTGCATTTGTGTGTGATGTTGGATAGTCATCCACGCTCAGTTTGGACCATTGGAGGAACTTA 721 GTGTCACGCACAAATGGGGCTATTCCTACGCTTAGAATAGGGCTTGTCTGCCCACTTTAGAAGAGTCCAGGTTGGTGAGC 801 ATTTAGAGGGAAGCAGGGCAGAACTCTGAACGACAATACGTCTCTCTGAGCAGAGACCCCTTTGTTCTTGTTATCCACCC 881 ATATGGACTTGGAATCAATCTTGCCAAATATTTGGAGAGATTGTGTGGATTTAAGAGACCTGGATTTTTATATTTTACCA 961 GTAAATAAAAGTTTTCATTGATATCTGTCCTTGAAACTTGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_020313 | 3UTR | CCAUCCCCAACCACAUUUGACUGUAGCAUUGCAUCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000565961.1 | 3UTR | CCCCCUUCCAUCCCCAACCACAUUUGACUGUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
96 hsa-miR-2110 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT035757 | BRD4 | bromodomain containing 4 | 1 | 1 | ||||||||
MIRT035758 | NCOR2 | nuclear receptor corepressor 2 | 1 | 1 | ||||||||
MIRT035759 | FASN | fatty acid synthase | 1 | 1 | ||||||||
MIRT035760 | C10orf118 | coiled-coil domain containing 186 | 1 | 1 | ||||||||
MIRT055403 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | 2 | 6 | ||||||||
MIRT066205 | MARCH9 | membrane associated ring-CH-type finger 9 | 2 | 2 | ||||||||
MIRT079365 | CCDC137 | coiled-coil domain containing 137 | 2 | 2 | ||||||||
MIRT081180 | MIDN | midnolin | 2 | 4 | ||||||||
MIRT082397 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | 2 | 4 | ||||||||
MIRT089000 | BCL11A | B-cell CLL/lymphoma 11A | 2 | 2 | ||||||||
MIRT133706 | SKI | SKI proto-oncogene | 2 | 4 | ||||||||
MIRT160053 | TET3 | tet methylcytosine dioxygenase 3 | 2 | 4 | ||||||||
MIRT180853 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | 2 | 2 | ||||||||
MIRT263243 | SGPL1 | sphingosine-1-phosphate lyase 1 | 2 | 2 | ||||||||
MIRT285532 | CDT1 | chromatin licensing and DNA replication factor 1 | 2 | 2 | ||||||||
MIRT317152 | E2F3 | E2F transcription factor 3 | 2 | 4 | ||||||||
MIRT321166 | EIF4H | eukaryotic translation initiation factor 4H | 2 | 2 | ||||||||
MIRT441482 | NCEH1 | neutral cholesterol ester hydrolase 1 | 2 | 2 | ||||||||
MIRT443884 | CNKSR3 | CNKSR family member 3 | 2 | 2 | ||||||||
MIRT445877 | WBP1L | WW domain binding protein 1 like | 2 | 2 | ||||||||
MIRT446195 | GTPBP4 | GTP binding protein 4 | 2 | 2 | ||||||||
MIRT449308 | MRO | maestro | 2 | 2 | ||||||||
MIRT450301 | DRAXIN | dorsal inhibitory axon guidance protein | 2 | 2 | ||||||||
MIRT450512 | EMX1 | empty spiracles homeobox 1 | 2 | 2 | ||||||||
MIRT451534 | CIAPIN1 | cytokine induced apoptosis inhibitor 1 | 2 | 2 | ||||||||
MIRT451820 | ALDH3B1 | aldehyde dehydrogenase 3 family member B1 | 2 | 2 | ||||||||
MIRT452239 | TRAM1 | translocation associated membrane protein 1 | 2 | 2 | ||||||||
MIRT454207 | HLA-A | major histocompatibility complex, class I, A | 2 | 2 | ||||||||
MIRT455447 | EPB41L4B | erythrocyte membrane protein band 4.1 like 4B | 2 | 2 | ||||||||
MIRT456496 | PFKFB2 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 | 2 | 2 | ||||||||
MIRT457656 | SERINC1 | serine incorporator 1 | 2 | 2 | ||||||||
MIRT459819 | TPP1 | tripeptidyl peptidase 1 | 2 | 2 | ||||||||
MIRT460556 | FEM1A | fem-1 homolog A | 2 | 2 | ||||||||
MIRT462561 | STS | steroid sulfatase | 2 | 2 | ||||||||
MIRT462986 | ZNF740 | zinc finger protein 740 | 2 | 2 | ||||||||
MIRT464671 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | 2 | 2 | ||||||||
MIRT465432 | TP53 | tumor protein p53 | 2 | 2 | ||||||||
MIRT465934 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | 2 | 2 | ||||||||
MIRT466015 | TMEM189 | transmembrane protein 189 | 2 | 2 | ||||||||
MIRT468122 | SH3PXD2A | SH3 and PX domains 2A | 2 | 2 | ||||||||
MIRT469652 | RAC1 | Rac family small GTPase 1 | 2 | 2 | ||||||||
MIRT469980 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | 2 | 2 | ||||||||
MIRT473531 | MAX | MYC associated factor X | 2 | 2 | ||||||||
MIRT473596 | MARK2 | microtubule affinity regulating kinase 2 | 2 | 2 | ||||||||
MIRT473652 | MARCKSL1 | MARCKS like 1 | 2 | 2 | ||||||||
MIRT474219 | LCOR | ligand dependent nuclear receptor corepressor | 2 | 4 | ||||||||
MIRT474771 | KIAA0895L | KIAA0895 like | 2 | 2 | ||||||||
MIRT479312 | VPS72 | vacuolar protein sorting 72 homolog | 2 | 2 | ||||||||
MIRT481121 | AZIN1 | antizyme inhibitor 1 | 2 | 4 | ||||||||
MIRT481682 | AR | androgen receptor | 2 | 2 | ||||||||
MIRT482381 | AEN | apoptosis enhancing nuclease | 2 | 2 | ||||||||
MIRT483833 | UNC5B | unc-5 netrin receptor B | 2 | 4 | ||||||||
MIRT484693 | RNF11 | ring finger protein 11 | 2 | 2 | ||||||||
MIRT485238 | POGZ | pogo transposable element derived with ZNF domain | 2 | 2 | ||||||||
MIRT488748 | FXYD1 | FXYD domain containing ion transport regulator 1 | 2 | 2 | ||||||||
MIRT489147 | MRPL12 | mitochondrial ribosomal protein L12 | 2 | 4 | ||||||||
MIRT489518 | MRE11A | MRE11 homolog, double strand break repair nuclease | 2 | 8 | ||||||||
MIRT498908 | SRCAP | Snf2 related CREBBP activator protein | 2 | 2 | ||||||||
MIRT506426 | NAGK | N-acetylglucosamine kinase | 2 | 6 | ||||||||
MIRT506640 | MAPK1 | mitogen-activated protein kinase 1 | 2 | 4 | ||||||||
MIRT507332 | FAM168A | family with sequence similarity 168 member A | 2 | 2 | ||||||||
MIRT513099 | DYNAP | dynactin associated protein | 2 | 2 | ||||||||
MIRT513514 | YIPF4 | Yip1 domain family member 4 | 2 | 6 | ||||||||
MIRT521800 | POM121C | POM121 transmembrane nucleoporin C | 2 | 2 | ||||||||
MIRT525078 | FRK | fyn related Src family tyrosine kinase | 2 | 2 | ||||||||
MIRT530927 | SCIN | scinderin | 2 | 2 | ||||||||
MIRT533498 | TRIM71 | tripartite motif containing 71 | 2 | 2 | ||||||||
MIRT536787 | HNRNPD | heterogeneous nuclear ribonucleoprotein D | 2 | 2 | ||||||||
MIRT544554 | CSNK2A1 | casein kinase 2 alpha 1 | 2 | 2 | ||||||||
MIRT552977 | VAT1 | vesicle amine transport 1 | 2 | 2 | ||||||||
MIRT557358 | HAND1 | heart and neural crest derivatives expressed 1 | 2 | 2 | ||||||||
MIRT560401 | TMEM69 | transmembrane protein 69 | 2 | 2 | ||||||||
MIRT565498 | SP1 | Sp1 transcription factor | 2 | 2 | ||||||||
MIRT568962 | CACNA1C | calcium voltage-gated channel subunit alpha1 C | 2 | 2 | ||||||||
MIRT569031 | IL21R | interleukin 21 receptor | 2 | 2 | ||||||||
MIRT573224 | TRIM21 | tripartite motif containing 21 | 2 | 2 | ||||||||
MIRT574312 | ZNF703 | zinc finger protein 703 | 2 | 2 | ||||||||
MIRT620395 | MYO1H | myosin IH | 2 | 2 | ||||||||
MIRT620936 | OSMR | oncostatin M receptor | 2 | 2 | ||||||||
MIRT638166 | TMED4 | transmembrane p24 trafficking protein 4 | 2 | 2 | ||||||||
MIRT647743 | SAMD9L | sterile alpha motif domain containing 9 like | 2 | 2 | ||||||||
MIRT649991 | MSI1 | musashi RNA binding protein 1 | 2 | 2 | ||||||||
MIRT669203 | CBX8 | chromobox 8 | 2 | 2 | ||||||||
MIRT684546 | ZNF708 | zinc finger protein 708 | 2 | 2 | ||||||||
MIRT685837 | ANGEL1 | angel homolog 1 | 2 | 2 | ||||||||
MIRT688547 | DCAF16 | DDB1 and CUL4 associated factor 16 | 2 | 2 | ||||||||
MIRT693252 | HBS1L | HBS1 like translational GTPase | 2 | 2 | ||||||||
MIRT701970 | MIER3 | MIER family member 3 | 2 | 2 | ||||||||
MIRT706385 | MC2R | melanocortin 2 receptor | 2 | 2 | ||||||||
MIRT707484 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | 2 | 2 | ||||||||
MIRT711882 | INSIG2 | insulin induced gene 2 | 2 | 2 | ||||||||
MIRT716906 | CACNB2 | calcium voltage-gated channel auxiliary subunit beta 2 | 2 | 2 | ||||||||
MIRT717638 | HLX | H2.0 like homeobox | 2 | 2 | ||||||||
MIRT719058 | ZNF281 | zinc finger protein 281 | 2 | 2 | ||||||||
MIRT723754 | NKIRAS2 | NFKB inhibitor interacting Ras like 2 | 2 | 2 | ||||||||
MIRT725479 | GPR26 | G protein-coupled receptor 26 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|