>ILK|NM_001014794|3'UTR
   1 GACTGGAAGGTCCTTGCCTGAACTCCAGAGGTGTCGGGACATGGTTGGGGGAATGCACCTCCCCAAAGCAGCAGGCCTCT
  81 GGTTGCCTCCCCCGCCTCCAGTCATGGTACTACCCCAGCCATGGGGTCCATCCCCTTCCCCCATCCCTACCACTGTGGCC
 161 CCAAGAGGGGCGGGCTCAGAGCTTTGTCACTTGCCACATGGTGTCTCCCAACATGGGAGGGATCAGCCCCGCCTGTCACA
 241 ATAAAGTTTATTATGAAAACAGGAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaUUCUGGUUCGGAGGAAGGGa 5' ::|::| | || ||||||| Target 5' atGGGGTCCATCC-CCTTCCCc 3'	121 - 141	155.00	-19.90
2	miRNA 3' gaUUC-UGGUUCGGA-------GGAAGGGa 5' ||| | ||:|||| ||| ||| Target 5' caAAGCAGCAGGCCTCTGGTTGCCTCCCCc 3'	64 - 93	128.00	-18.90
3	miRNA 3' gauuCUGG--UUCGGAGGAAGGGa 5' |||: ||| ||||| || Target 5' ----GACTGGAAG-GTCCTTGCCt 3'	1 - 19	123.00	-12.20

Mutant ID	Mutant Position	Mutant Source
390863	3	ClinVar
COSM8073510	1	COSMIC
COSN30532213	2	COSMIC
COSN31590168	13	COSMIC
COSN31960589	32	COSMIC
COSN30135225	36	COSMIC
COSN30486055	37	COSMIC
COSN32064374	75	COSMIC
COSN30694285	100	COSMIC
COSN26554734	102	COSMIC
COSN508752	128	COSMIC
COSN30498127	195	COSMIC
COSN29468847	204	COSMIC
COSN31613219	218	COSMIC
COSN31566381	225	COSMIC
COSN20077433	231	COSMIC
COSN30486271	259	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1400986012	1	dbSNP
rs778105132	3	dbSNP
rs761269914	6	dbSNP
rs749954343	10	dbSNP
rs1221198794	11	dbSNP
rs779914826	14	dbSNP
rs1209321656	17	dbSNP
rs746659166	18	dbSNP
rs1802876	19	dbSNP
rs915848427	26	dbSNP
rs1246695280	27	dbSNP
rs1467013854	28	dbSNP
rs768615003	29	dbSNP
rs781115248	35	dbSNP
rs367866686	36	dbSNP
rs769798748	37	dbSNP
rs1406665328	40	dbSNP
rs372063833	41	dbSNP
rs564146367	42	dbSNP
rs369548641	44	dbSNP
rs372079694	47	dbSNP
rs759721658	50	dbSNP
rs1304043724	52	dbSNP
rs1333070700	52	dbSNP
rs929085162	55	dbSNP
rs1336168476	60	dbSNP
rs151106636	62	dbSNP
rs935383166	71	dbSNP
rs911588445	73	dbSNP
rs1371877737	77	dbSNP
rs1195889512	83	dbSNP
rs1429491891	87	dbSNP
rs916910026	89	dbSNP
rs1271681407	92	dbSNP
rs988778518	94	dbSNP
rs946852662	95	dbSNP
rs943053548	99	dbSNP
rs553068809	105	dbSNP
rs894065148	106	dbSNP
rs1229435731	110	dbSNP
rs929676452	113	dbSNP
rs141101891	114	dbSNP
rs1277367487	122	dbSNP
rs1040811910	125	dbSNP
rs900829518	126	dbSNP
rs1448081505	127	dbSNP
rs879200127	134	dbSNP
rs1218613998	136	dbSNP
rs1409471952	137	dbSNP
rs769678637	139	dbSNP
rs1011042552	141	dbSNP
rs1394349501	143	dbSNP
rs993878543	147	dbSNP
rs1488141702	148	dbSNP
rs780189031	158	dbSNP
rs1200644169	167	dbSNP
rs1479274971	169	dbSNP
rs1042984152	172	dbSNP
rs1025953040	178	dbSNP
rs1199061187	192	dbSNP
rs902594768	202	dbSNP
rs1436728263	203	dbSNP
rs1247800494	205	dbSNP
rs2739501	208	dbSNP
rs1197545575	209	dbSNP
rs879909660	214	dbSNP
rs1046782932	215	dbSNP
rs1262322708	216	dbSNP
rs888387965	219	dbSNP
rs1325352597	227	dbSNP
rs1431639588	227	dbSNP
rs541609708	231	dbSNP
rs555530162	232	dbSNP
rs1035116395	242	dbSNP
rs959336811	247	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.