miRTarBase - #MIRT451946


—
pre-miRNA Information
pre-miRNA hsa-mir-3175   
Genomic Coordinates chr15: 92904399 - 92904475
Description Homo sapiens miR-3175 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3175
Sequence 10| CGGGGAGAGAACGCAGUGACGU |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1449291045 4 dbSNP
rs372141302 4 dbSNP
rs72647784 4 dbSNP
rs1209664292 5 dbSNP
rs563454166 6 dbSNP
rs915251599 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMPRSS5   
Synonyms SPINESIN
Description transmembrane protease, serine 5
Transcript NM_030770   
Expression
Putative miRNA Targets on TMPRSS5
3'UTR of TMPRSS5
(miRNA target sites are highlighted)		 
>TMPRSS5|NM_030770|3'UTR
   1 GTCCTGCTGTTTCCTCCAGTCTCACTGCACACCACTGCCTCATGCTTCCTGGGGCCTCCAGCAGCTCCACTAATGGAGGA
  81 GAGGCAGTAGCCTCCGACACAGAACGCATGGACCTCCTACTACTGTGTGTGAGGAACAGTCACTACCCACTGGCCAGCCA
 161 CCCAGCCAACAGGTCTCTCCTCTTGGGCCCTGATTTCAGAGTCCTCTTTCTCACTAGAGACTCAATGACAGAAGAGAGGC
 241 TGGGACTTGGTTGGGCATGCTGTGGTTGCTGAGGGATGAGGGGGAGGAGAGAGGTAGGAGCTGGAGATGAAGAGGCTGCT
 321 AGAAGCAGCAGGAAGCCTGCCCTTCTGCCCTCTCCCCTCCCTGCCCCTGTGTGAGTCTTTTGGGAGGGTGCTGGGAGGTG
 401 CCCCCCGTCCCACCTTTTTCCTGTGCTCTAGGTGGGCTAAGTGCCTCCCTAGAGGACTCCATGGCTGAGAGGCTCCTGGG
 481 CAGATGGGGTCAAGGCTGGGCCAGCCCAGATGAAGCCTATGGGAGTCAGGACCCTCTCCACTCTCCCTCTCCACTCCCCT
 561 TCCTGTTCTCACCTGGCTGTGGCTGGCCCTGTGTGGGGTGGGTACACTGGAAAACAAGAAGGTTGGAGTTGGTCTAGGAC
 641 ATTGGTTTTAAATGACAGTTCTGTGAACTGGTCCAAGGAGTTCTGTTATTAAAGTGATATATGGTCTTGGTCCAAAAAAA
 721 AAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugCAGUGACGCAAGAGAGGGGc 5'
            | | :| :|  |||||||| 
Target 5' ctGCCCTTCTGCCCTCTCCCCt 3'
 337 - 358 152.00 -18.50
2 
miRNA  3' ugcagugacgCAAGAGAGGGGc 5'
                    | |||||||:| 
Target 5' ccagccaacaGGTCTCTCCTCt 3'
 162 - 183 136.00 -13.60
3 
miRNA  3' ugCAGUGACGCAAGAGAGGGGc 5'
            | | || :   |||||||: 
Target 5' agGACCCTCTCCACTCTCCCTc 3'
 528 - 549 132.00 -16.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1179359 137 ClinVar
COSN31491170 23 COSMIC
COSN30126302 95 COSMIC
COSN6986094 105 COSMIC
COSN30160735 212 COSMIC
COSN20184934 227 COSMIC
COSN31559635 234 COSMIC
COSN6986093 709 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758992928 18 dbSNP
rs1266861397 22 dbSNP
rs1210317856 23 dbSNP
rs1221766370 25 dbSNP
rs774055582 31 dbSNP
rs371377044 34 dbSNP
rs796197507 34 dbSNP
rs770677868 36 dbSNP
rs749017479 50 dbSNP
rs1002475921 53 dbSNP
rs1249666836 54 dbSNP
rs1419480383 68 dbSNP
rs986027595 70 dbSNP
rs1415584030 72 dbSNP
rs1433692654 74 dbSNP
rs1428655965 79 dbSNP
rs377205552 87 dbSNP
rs954689684 90 dbSNP
rs116205432 92 dbSNP
rs547367520 95 dbSNP
rs1373189511 96 dbSNP
rs1181810092 105 dbSNP
rs1480184934 106 dbSNP
rs1249445863 107 dbSNP
rs1369121388 109 dbSNP
rs961784386 119 dbSNP
rs1279521533 121 dbSNP
rs1212124733 124 dbSNP
rs945133826 126 dbSNP
rs1016029990 132 dbSNP
rs17115826 137 dbSNP
rs1200360297 138 dbSNP
rs1250893848 142 dbSNP
rs139161036 154 dbSNP
rs1023205652 171 dbSNP
rs545275655 173 dbSNP
rs1169095294 174 dbSNP
rs926220175 179 dbSNP
rs985714731 181 dbSNP
rs1333861955 182 dbSNP
rs932865269 192 dbSNP
rs1371586737 200 dbSNP
rs1392737863 201 dbSNP
rs531556352 202 dbSNP
rs1305008739 204 dbSNP
rs922813231 208 dbSNP
rs1449259650 226 dbSNP
rs1369953997 230 dbSNP
rs895963977 231 dbSNP
rs1294917221 232 dbSNP
rs1405911719 234 dbSNP
rs976878229 249 dbSNP
rs1271123256 251 dbSNP
rs1458879960 252 dbSNP
rs961461231 255 dbSNP
rs1221977796 269 dbSNP
rs1057339661 271 dbSNP
rs934826904 273 dbSNP
rs1412879861 280 dbSNP
rs1015678006 281 dbSNP
rs1158618483 282 dbSNP
rs903240003 283 dbSNP
rs1043133478 295 dbSNP
rs1324586744 300 dbSNP
rs1351887637 304 dbSNP
rs947365756 313 dbSNP
rs910574851 314 dbSNP
rs986004560 315 dbSNP
rs933294100 326 dbSNP
rs1291397135 330 dbSNP
rs1334030502 334 dbSNP
rs1417610315 336 dbSNP
rs1403406007 337 dbSNP
rs923186147 338 dbSNP
rs971891164 340 dbSNP
rs774544253 345 dbSNP
rs1465844275 347 dbSNP
rs952731126 350 dbSNP
rs984563916 359 dbSNP
rs146829461 363 dbSNP
rs367575682 363 dbSNP
rs1034068678 365 dbSNP
rs1013581593 366 dbSNP
rs1164259310 369 dbSNP
rs1201758819 374 dbSNP
rs1330593663 386 dbSNP
rs1001123003 399 dbSNP
rs1361366357 403 dbSNP
rs1002146014 406 dbSNP
rs906405170 407 dbSNP
rs1354804231 434 dbSNP
rs1237847962 436 dbSNP
rs769209859 441 dbSNP
rs1370921584 444 dbSNP
rs1009349556 449 dbSNP
rs1286329953 451 dbSNP
rs892256986 455 dbSNP
rs1053448015 462 dbSNP
rs1355368377 471 dbSNP
rs936368584 472 dbSNP
rs562892547 473 dbSNP
rs888798108 475 dbSNP
rs1043103264 480 dbSNP
rs1188860258 481 dbSNP
rs1382579435 486 dbSNP
rs1425417860 489 dbSNP
rs1050490108 494 dbSNP
rs932921281 495 dbSNP
rs922810330 505 dbSNP
rs544481854 506 dbSNP
rs1381203310 507 dbSNP
rs1165953046 511 dbSNP
rs1421739331 516 dbSNP
rs976951837 517 dbSNP
rs562665843 519 dbSNP
rs17115824 521 dbSNP
rs574852578 523 dbSNP
rs933328088 534 dbSNP
rs1333871160 538 dbSNP
rs76470159 557 dbSNP
rs984217775 559 dbSNP
rs193296183 563 dbSNP
rs572061965 565 dbSNP
rs759036413 570 dbSNP
rs1302154715 573 dbSNP
rs13606 581 dbSNP
rs970705774 582 dbSNP
rs1417485716 587 dbSNP
rs1445000623 594 dbSNP
rs1004352581 599 dbSNP
rs1024847035 605 dbSNP
rs1238044103 607 dbSNP
rs78936131 611 dbSNP
rs1009377321 615 dbSNP
rs1201624898 629 dbSNP
rs753176964 632 dbSNP
rs1436553825 636 dbSNP
rs892286145 641 dbSNP
rs984529773 642 dbSNP
rs1032104553 643 dbSNP
rs1441854040 652 dbSNP
rs1191995782 653 dbSNP
rs1377231536 656 dbSNP
rs1000636630 658 dbSNP
rs1174362750 669 dbSNP
rs538912894 670 dbSNP
rs1050103401 671 dbSNP
rs1402202384 672 dbSNP
rs1262368167 676 dbSNP
rs539621068 678 dbSNP
rs1484615703 691 dbSNP
rs1266831706 695 dbSNP
rs556697293 698 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcagugacgcaaGAGAGGGGc 5'
                       |||||||| 
Target 5' -----------ccCUCUCCCCu 3'
 		1 - 11
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000536856.1 | 3UTR | CCCUCUCCCCUCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
208 hsa-miR-3175 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118211 KHSRP KH-type splicing regulatory protein 2 2
MIRT131222 ATG2A autophagy related 2A 2 2
MIRT143733 CCL22 C-C motif chemokine ligand 22 2 2
MIRT151435 ZBTB7A zinc finger and BTB domain containing 7A 2 4
MIRT191759 ZNF410 zinc finger protein 410 2 2
MIRT267302 TMEM109 transmembrane protein 109 2 2
MIRT273435 DAZAP2 DAZ associated protein 2 2 4
MIRT286061 HIC1 HIC ZBTB transcriptional repressor 1 2 2
MIRT288597 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT316768 FOXC1 forkhead box C1 2 4
MIRT331065 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 4
MIRT398528 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT443842 RGS6 regulator of G protein signaling 6 2 2
MIRT446200 GTPBP4 GTP binding protein 4 2 2
MIRT448039 SFRP1 secreted frizzled related protein 1 2 2
MIRT451946 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT453239 FTSJ3 FtsJ RNA methyltransferase homolog 3 2 2
MIRT453501 ARRB1 arrestin beta 1 2 2
MIRT453541 PRR12 proline rich 12 2 2
MIRT453953 ENTHD1 ENTH domain containing 1 2 2
MIRT454209 HLA-A major histocompatibility complex, class I, A 2 2
MIRT455501 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT455620 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 10
MIRT455631 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 10
MIRT456074 AFF2 AF4/FMR2 family member 2 2 6
MIRT456149 TTF2 transcription termination factor 2 2 2
MIRT456309 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 2 2
MIRT456444 TMEM81 transmembrane protein 81 2 2
MIRT456685 LDB1 LIM domain binding 1 2 2
MIRT457516 ZMAT5 zinc finger matrin-type 5 2 2
MIRT457599 IDS iduronate 2-sulfatase 2 2
MIRT457949 ABCC5 ATP binding cassette subfamily C member 5 2 6
MIRT458593 KCTD2 potassium channel tetramerization domain containing 2 2 2
MIRT459505 TACR3 tachykinin receptor 3 2 2
MIRT459687 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459914 HHIP hedgehog interacting protein 2 11
MIRT460610 FEM1A fem-1 homolog A 2 2
MIRT460646 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT461454 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461909 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462059 CCDC77 coiled-coil domain containing 77 2 4
MIRT462404 RBM28 RNA binding motif protein 28 2 2
MIRT462589 MYL12A myosin light chain 12A 2 2
MIRT462770 ZNF8 zinc finger protein 8 2 2
MIRT462991 ZNF740 zinc finger protein 740 2 2
MIRT463680 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464112 VPS35 VPS35, retromer complex component 2 2
MIRT464414 UNC13A unc-13 homolog A 2 6
MIRT464608 UBE4B ubiquitination factor E4B 2 2
MIRT465679 TNPO2 transportin 2 2 2
MIRT467225 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT469316 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469604 RALGAPA2 Ral GTPase activating protein catalytic alpha subunit 2 2 2
MIRT469655 RAC1 Rac family small GTPase 1 2 2
MIRT469744 RAB2B RAB2B, member RAS oncogene family 2 2
MIRT469947 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT470140 PSME3 proteasome activator subunit 3 2 2
MIRT473142 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT473287 MFRP membrane frizzled-related protein 2 2
MIRT473379 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 6
MIRT473661 MARCKSL1 MARCKS like 1 2 2
MIRT475256 IGF1R insulin like growth factor 1 receptor 2 2
MIRT475361 ICOSLG inducible T-cell costimulator ligand 2 4
MIRT475662 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT476524 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT476572 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT477624 EFNA1 ephrin A1 2 2
MIRT478125 DIRAS1 DIRAS family GTPase 1 2 2
MIRT479971 CARD10 caspase recruitment domain family member 10 2 2
MIRT480144 CALR calreticulin 2 2
MIRT480349 C5orf24 chromosome 5 open reading frame 24 2 2
MIRT480402 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480741 BNC2 basonuclin 2 2 8
MIRT481987 AMOTL2 angiomotin like 2 2 2
MIRT482650 FAM195B MAPK regulated corepressor interacting protein 1 2 4
MIRT482809 TRAF6 TNF receptor associated factor 6 2 2
MIRT482945 ZNF561 zinc finger protein 561 2 6
MIRT482987 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT483123 ONECUT3 one cut homeobox 3 2 4
MIRT483253 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483580 SLC26A9 solute carrier family 26 member 9 2 2
MIRT483704 ASPH aspartate beta-hydroxylase 2 2
MIRT483932 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484140 LRRC45 leucine rich repeat containing 45 2 4
MIRT484195 SUMO1 small ubiquitin-like modifier 1 2 4
MIRT484353 GATA6 GATA binding protein 6 2 12
MIRT484472 DDX6 DEAD-box helicase 6 2 2
MIRT484544 BARHL1 BarH like homeobox 1 2 6
MIRT484572 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT485265 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT485376 MSN moesin 2 4
MIRT485763 B4GALT5 beta-1,4-galactosyltransferase 5 2 2
MIRT485882 AGO2 argonaute 2, RISC catalytic component 2 17
MIRT486242 FASTK Fas activated serine/threonine kinase 2 2
MIRT486431 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 2 2
MIRT486569 ZNF619 zinc finger protein 619 2 2
MIRT486608 METTL6 methyltransferase like 6 2 2
MIRT487442 TFAP2B transcription factor AP-2 beta 2 4
MIRT487577 FAM83H family with sequence similarity 83 member H 2 4
MIRT487812 PER3 period circadian clock 3 2 2
MIRT487944 ISCA1 iron-sulfur cluster assembly 1 2 2
MIRT487952 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT488011 GDF5OS growth differentiation factor 5 opposite strand 2 2
MIRT488311 LDOC1 LDOC1, regulator of NFKB signaling 2 2
MIRT488639 HAND2 heart and neural crest derivatives expressed 2 2 2
MIRT488651 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT488683 NAT9 N-acetyltransferase 9 (putative) 2 2
MIRT488846 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT488970 REXO2 RNA exonuclease 2 2 2
MIRT489002 FBXO40 F-box protein 40 2 2
MIRT489038 PRPF4B pre-mRNA processing factor 4B 2 2
MIRT489167 ANKRD45 ankyrin repeat domain 45 2 2
MIRT489221 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489356 SYNGR1 synaptogyrin 1 2 4
MIRT489373 RAB11B RAB11B, member RAS oncogene family 2 6
MIRT489526 MRE11A MRE11 homolog, double strand break repair nuclease 2 14
MIRT490071 PRRT2 proline rich transmembrane protein 2 2 2
MIRT490275 ZNF562 zinc finger protein 562 2 4
MIRT490696 FSTL4 follistatin like 4 2 2
MIRT490778 PSMD3 proteasome 26S subunit, non-ATPase 3 2 2
MIRT490854 UPK2 uroplakin 2 2 2
MIRT491048 CHST12 carbohydrate sulfotransferase 12 2 2
MIRT491123 PTPRE protein tyrosine phosphatase, receptor type E 2 2
MIRT491161 LRP3 LDL receptor related protein 3 2 2
MIRT491506 CREBL2 cAMP responsive element binding protein like 2 2 2
MIRT491532 HDAC5 histone deacetylase 5 2 2
MIRT491699 PDZD4 PDZ domain containing 4 2 2
MIRT491949 VPS52 VPS52, GARP complex subunit 2 2
MIRT492226 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492278 SHISA6 shisa family member 6 2 4
MIRT492472 RASD1 ras related dexamethasone induced 1 2 4
MIRT492480 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492498 RANBP10 RAN binding protein 10 2 4
MIRT492565 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT492702 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT492916 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT493020 NACC1 nucleus accumbens associated 1 2 2
MIRT493218 MEX3A mex-3 RNA binding family member A 2 2
MIRT493313 LIMD2 LIM domain containing 2 2 2
MIRT493410 KDM6B lysine demethylase 6B 2 2
MIRT493451 ITFG3 family with sequence similarity 234 member A 2 2
MIRT494028 DUSP7 dual specificity phosphatase 7 2 4
MIRT494329 CASKIN1 CASK interacting protein 1 2 2
MIRT496564 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT496771 ADAMTS14 ADAM metallopeptidase with thrombospondin type 1 motif 14 2 2
MIRT496973 RPS6KA2 ribosomal protein S6 kinase A2 2 2
MIRT497038 DYRK1B dual specificity tyrosine phosphorylation regulated kinase 1B 2 2
MIRT498913 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT499006 CCDC50 coiled-coil domain containing 50 2 2
MIRT499637 CREB3L2 cAMP responsive element binding protein 3 like 2 2 2
MIRT501700 PCGF3 polycomb group ring finger 3 2 6
MIRT502230 HOXC6 homeobox C6 2 2
MIRT502655 CTC1 CST telomere replication complex component 1 2 13
MIRT506246 PER1 period circadian clock 1 2 8
MIRT506430 NAGK N-acetylglucosamine kinase 2 6
MIRT507336 FAM168A family with sequence similarity 168 member A 2 2
MIRT507781 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT510062 C12orf49 chromosome 12 open reading frame 49 2 4
MIRT511935 FAM127B retrotransposon Gag like 8A 2 2
MIRT513037 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT513518 YIPF4 Yip1 domain family member 4 2 6
MIRT522612 MAP7D1 MAP7 domain containing 1 2 4
MIRT527162 ADRA2B adrenoceptor alpha 2B 2 2
MIRT535350 PFN1 profilin 1 2 2
MIRT536734 IER5 immediate early response 5 2 4
MIRT538505 CLIP1 CAP-Gly domain containing linker protein 1 2 2
MIRT544643 PHF8 PHD finger protein 8 2 4
MIRT544856 MYH2 myosin heavy chain 2 2 4
MIRT568898 ATP6V1B1 ATPase H+ transporting V1 subunit B1 2 2
MIRT568949 RUNX3 runt related transcription factor 3 2 2
MIRT568971 CACNA1C calcium voltage-gated channel subunit alpha1 C 2 2
MIRT569037 IL21R interleukin 21 receptor 2 2
MIRT569310 CC2D1B coiled-coil and C2 domain containing 1B 2 2
MIRT569721 GPR173 G protein-coupled receptor 173 2 2
MIRT569765 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT569857 KRT80 keratin 80 2 2
MIRT569867 KLK10 kallikrein related peptidase 10 2 2
MIRT569914 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570060 CPNE2 copine 2 2 2
MIRT570307 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT570982 RGS19 regulator of G protein signaling 19 2 2
MIRT571025 CLSTN1 calsyntenin 1 2 2
MIRT573215 NAT10 N-acetyltransferase 10 2 2
MIRT574633 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT574690 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT575732 Hhip Hedgehog-interacting protein 2 7
MIRT575837 Ago2 argonaute RISC catalytic subunit 2 2 10
MIRT631303 CBS cystathionine-beta-synthase 2 2
MIRT647750 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT648323 PLIN1 perilipin 1 2 2
MIRT649339 HEXA hexosaminidase subunit alpha 2 2
MIRT649994 MSI1 musashi RNA binding protein 1 2 2
MIRT661786 NLRC3 NLR family CARD domain containing 3 2 2
MIRT665992 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT667177 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT667386 MOB1B MOB kinase activator 1B 2 2
MIRT680929 EVC EvC ciliary complex subunit 1 2 2
MIRT691870 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT693258 HBS1L HBS1 like translational GTPase 2 2
MIRT693490 MOB3A MOB kinase activator 3A 2 2
MIRT696099 SETD1A SET domain containing 1A 2 2
MIRT697955 TSPYL1 TSPY like 1 2 2
MIRT699481 SLC10A6 solute carrier family 10 member 6 2 2
MIRT708274 ZNF101 zinc finger protein 101 2 2
MIRT712147 TAOK1 TAO kinase 1 2 2
MIRT717122 SOWAHA sosondowah ankyrin repeat domain family member A 2 2
MIRT717643 HLX H2.0 like homeobox 2 2
MIRT755336 DCAF1 DDB1 and CUL4 associated factor 1 6 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-3175 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-3175 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PATU8988)
hsa-miR-3175 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3175 Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3175 Temozolomide 5394 NSC362856 approved sensitive High Glioblastoma cell line (U251)
hsa-mir-3175 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-3175 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-3175 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-3175 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-3175 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-3175 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3175 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-3175 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-3175 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-3175 Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3175 Neoadjuvant chemotherapy resistant tissue (breast cancer)

Error report submission