>NLRP6|NM_138329|3'UTR
   1 GGCTCTGGTGGCCAGAGCAGGGTGGAAGACCCTAGTCAAAGTCCCTGTGGAGAGAACGGCCCATTCCAAGGGCAGGAGGA
  81 TATT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acUUGACGGACAGAGGAAGGac 5' ||| ||| | |||| Target 5' agAACGGCC-----CATTCCaa 3'	53 - 69	99.00	-9.86
2	miRNA 3' acuugacggacagaGGAaggac 5' ||| Target 5' gcagggtggaagacCCTagtca 3'	17 - 38	60.00	-7.50

Mutant ID	Mutant Position	Mutant Source
rs761605653	2	dbSNP
rs1178140207	3	dbSNP
rs890042154	7	dbSNP
rs767102299	9	dbSNP
rs749965584	12	dbSNP
rs756060460	13	dbSNP
rs201325771	14	dbSNP
rs753848267	16	dbSNP
rs754685501	19	dbSNP
rs1461184903	21	dbSNP
rs778732241	22	dbSNP
rs537580511	23	dbSNP
rs1473386605	25	dbSNP
rs747205041	26	dbSNP
rs368082311	29	dbSNP
rs1459218936	31	dbSNP
rs201286420	34	dbSNP
rs745878245	35	dbSNP
rs1405588570	42	dbSNP
rs769923236	44	dbSNP
rs775820174	46	dbSNP
rs1359693977	48	dbSNP
rs1258196018	49	dbSNP
rs573909203	55	dbSNP
rs1379047586	58	dbSNP
rs1316848813	59	dbSNP
rs1307849352	63	dbSNP
rs1240271886	70	dbSNP
rs185352194	72	dbSNP
rs572718606	77	dbSNP
rs1035923240	79	dbSNP
rs553096360	80	dbSNP
rs1402631953	83	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.