>HAVCR1|NM_001173393|3'UTR
   1 GACCCAGTGGTGCTCTTTGAGAGTTTACGCCCATGAGTGCAGAAGACTGAACAGACATCAGCACATCAGACGTCTTTTAG
  81 ACCCCAAGACAATTTTTCTGTTTCAGTTTCATCTGGCATTCCAACATGTCAGTGATACTGGGTAGAGTAACTCTCTCACT
 161 CCAAACTGTGTATAGTCAACCTCATCATTAATGTAGTCCTAATTTTTTATGCTAAAACTGGCTCAATCCTTCTGATCATT
 241 GCAGTTTTCTCTCAAATATGAACACTTTATAATTGTATGTTCTTTTTAGACCCCATAAATCCTGTATACATCAAAGAGAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' guaccagGGUGGAGGGACGGAc 5' | |::|::|||::| Target 5' cccaagaCAATTTTTCTGTTTc 3'	83 - 104	107.00	-10.20
2	miRNA 3' guaccaGGGUG-GAGGGACGGAc 5' ||||: :||||: | Target 5' ttagacCCCATAAATCCTGTATa 3'	286 - 308	100.00	-13.72
3	miRNA 3' guACCAGGGUGGAGGGACggac 5' ||| :| |:| ::||| Target 5' acTGGCTCAATCCTTCTGatca 3'	217 - 238	88.00	-14.10

Mutant ID	Mutant Position	Mutant Source
COSM8725961	9	COSMIC
COSM7785849	11	COSMIC
COSM7105738	15	COSMIC
COSM8389976	27	COSMIC
COSM7618578	28	COSMIC
COSM8208238	31	COSMIC
COSM7549841	88	COSMIC
COSM9022518	98	COSMIC
COSM7920395	104	COSMIC
COSM7940885	110	COSMIC
COSM8777358	113	COSMIC
COSM7961342	115	COSMIC
COSN28758293	161	COSMIC
COSN30704088	222	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs979866131	1	dbSNP
rs772667379	4	dbSNP
rs780853400	5	dbSNP
rs373813178	10	dbSNP
rs111759551	13	dbSNP
rs1401813280	19	dbSNP
rs1415210771	21	dbSNP
rs1445638698	22	dbSNP
rs770483110	23	dbSNP
rs950729585	27	dbSNP
rs1177354352	28	dbSNP
rs137884244	29	dbSNP
rs777473215	30	dbSNP
rs1382342181	31	dbSNP
rs755774394	33	dbSNP
rs1319495904	34	dbSNP
rs145237072	35	dbSNP
rs780983817	37	dbSNP
rs1354025879	39	dbSNP
rs1201775774	43	dbSNP
rs1281889926	45	dbSNP
rs181656381	47	dbSNP
rs369159990	48	dbSNP
rs1017369783	53	dbSNP
rs1306961488	55	dbSNP
rs768944549	56	dbSNP
rs751500388	57	dbSNP
rs1298753044	60	dbSNP
rs746516163	64	dbSNP
rs766292669	66	dbSNP
rs1179256735	67	dbSNP
rs571014946	71	dbSNP
rs1165736724	72	dbSNP
rs753914129	74	dbSNP
rs1380140509	82	dbSNP
rs1157383414	83	dbSNP
rs1051537562	88	dbSNP
rs764346701	91	dbSNP
rs1190073482	92	dbSNP
rs761010730	97	dbSNP
rs1248063563	98	dbSNP
rs749667001	100	dbSNP
rs775949578	101	dbSNP
rs772581266	105	dbSNP
rs1242056598	106	dbSNP
rs1317384019	113	dbSNP
rs1300528684	116	dbSNP
rs1386238060	117	dbSNP
rs1365630502	126	dbSNP
rs1305161651	128	dbSNP
rs760055918	131	dbSNP
rs1331111296	135	dbSNP
rs774921639	139	dbSNP
rs1296679975	141	dbSNP
rs190777889	142	dbSNP
rs1364840941	149	dbSNP
rs1176024751	155	dbSNP
rs1328038575	156	dbSNP
rs775526063	158	dbSNP
rs749057166	164	dbSNP
rs1199690580	168	dbSNP
rs1487718675	170	dbSNP
rs1260607158	172	dbSNP
rs1208289483	173	dbSNP
rs1218456196	174	dbSNP
rs1486087824	180	dbSNP
rs1255304440	181	dbSNP
rs1231038560	182	dbSNP
rs546280208	187	dbSNP
rs1266783262	189	dbSNP
rs748813773	190	dbSNP
rs1452318799	196	dbSNP
rs577372715	209	dbSNP
rs1231434221	212	dbSNP
rs1472375193	220	dbSNP
rs1160400860	221	dbSNP
rs1414593172	234	dbSNP
rs752467194	238	dbSNP
rs1163125308	239	dbSNP
rs778632402	255	dbSNP
rs1343585342	256	dbSNP
rs917000959	275	dbSNP
rs983554812	277	dbSNP
rs1410001515	278	dbSNP
rs1289991168	294	dbSNP
rs1405065955	304	dbSNP
rs748965107	309	dbSNP
rs1266032159	316	dbSNP
rs554046011	320	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.