>TG|NM_003235|3'UTR
   1 CCAGCCCTTGAGCTCCCCAAAAACCTCACCCGAGGCTGCCCACTATGGTCATCTTTTTCTCTAAAATAGCCACTTACCTT
  81 CAATAAAGTATCTACATGCGGTGAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgaGGUC-AGAGCUGCAAGGGcccc 5' |||| ||:|| | |||| Target 5' ---CCAGCCCTTGA-GCTCCCcaaa 3'	1 - 21	104.00	-13.96
2	miRNA 3' cgAGGUCAGAGCUGCAAGGGcccc 5' | ::||| : : |||:| Target 5' acTATGGTCATCTTTTTCTCtaaa 3'	42 - 65	78.00	-6.66
3	miRNA 3' cgaggUCAGAGCUGCAAGGGCCcc 5' ||| || || : ||| Target 5' aataaAGTATCTACA--TGCGGtg 3'	82 - 103	62.00	-7.50

Mutant ID	Mutant Position	Mutant Source
COSN19669432	12	COSMIC
COSN30539670	24	COSMIC
COSN30624465	24	COSMIC
COSN30151112	28	COSMIC
COSN30478239	28	COSMIC
COSN30466107	32	COSMIC
COSN30447854	42	COSMIC
COSN26998433	46	COSMIC
COSN31566203	54	COSMIC
COSN30534811	55	COSMIC
COSN31592220	59	COSMIC
COSN30146730	73	COSMIC
COSN31514704	78	COSMIC
COSN511119	89	COSMIC
COSN30159230	100	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1232563654	2	dbSNP
rs757135262	3	dbSNP
rs1209475848	4	dbSNP
rs757308206	9	dbSNP
rs781695424	19	dbSNP
rs1275267193	23	dbSNP
rs746371776	24	dbSNP
rs775938055	26	dbSNP
rs10571	28	dbSNP
rs771787440	30	dbSNP
rs372394787	32	dbSNP
rs760309222	33	dbSNP
rs376416123	34	dbSNP
rs1206268117	36	dbSNP
rs928803313	38	dbSNP
rs759528154	39	dbSNP
rs752571733	40	dbSNP
rs1422521971	46	dbSNP
rs1320936953	48	dbSNP
rs1385728231	49	dbSNP
rs762610512	51	dbSNP
rs1394827084	52	dbSNP
rs1327467493	54	dbSNP
rs577158392	66	dbSNP
rs1410895441	74	dbSNP
rs1199293995	77	dbSNP
rs1270300801	81	dbSNP
rs1435268573	84	dbSNP
rs934003431	85	dbSNP
rs776217576	91	dbSNP
rs1041595049	92	dbSNP
rs924529879	95	dbSNP
rs544385940	97	dbSNP
rs759134639	100	dbSNP
rs931296291	101	dbSNP
rs1274756357	106	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.