>LY6E|NM_001127213|3'UTR
   1 CCGCCCAGACCCTGTCCCCCGATCCCCCAGCTCAGGAAGGAAAGCCCAGCCCTTTCTGGATCCCACAGTGTATGGGAGCC
  81 CCTGACTCCTCACGTGCCTGATCTGTGCCCTTGGTCCCAGGTCAGGCCCACCCCCTGCACCTCCACCTGCCCCAGCCCCT
 161 GCCTCTGCCCCAAGTGGGGCCAGCTGCCCTCACTTCTGGGGTGGATGATGTGACCTTCCTTGGGGGACTGCGGAAGGGAC
 241 GAGGGTTCCCTGGAGTCTTACGGTCCAACATCAGGACCAAGTCCCATGGACATGCTGACAGGGTCCCCAGGGAGACCGTG
 321 TCAGTAGGGATGTGTGCCTGGCTGTGTACGTGGGTGTGCAGTGCACGTGAGAGCACGTGGCGGCTTCTGGGGGCCATGTT
 401 TGGGGAGGGAGGTGTGCCAGCAGCCTGGAGAGCCTCAGTCCCTGTAGCCCCCTGCCCTGGCACAGCTGCATGCACTTCAA
 481 GGGCAGCCTTTGGGGGTTGGGGTTTCTGCCACTTCCGGGTCTAGGCCCTGCCCCAAATCCAGCCAGTCCTGCCCCAGCCC
 561 ACCCCCACATTGGAGCCCTCCTGCTGCTTTGGTGCCTCAAATAAATACAGATGTCCCCCAGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acgUUAGG--GGUCGGGACGa 5' ||||| ||||:||||| Target 5' ccaAATCCAGCCAGTCCTGCc 3'	533 - 553	154.00	-22.10
2	miRNA 3' acGUUAGGGGUCGGGACGa 5' |:: :|: :||||||| Target 5' tcCGGGTCTAGGCCCTGCc 3'	514 - 532	149.00	-17.70
3	miRNA 3' acGUUAGGGGUCGGGACga 5' :|: |||| |||||| Target 5' tgTAGCCCCCTGCCCTGgc 3'	443 - 461	141.00	-24.60

Mutant ID	Mutant Position	Mutant Source
COSN31956571	3	COSMIC
COSN26983276	12	COSMIC
COSN19507130	21	COSMIC
COSN30500129	25	COSMIC
COSN30452825	48	COSMIC
COSN30454653	63	COSMIC
COSN30512017	65	COSMIC
COSN8575662	109	COSMIC
COSN30527042	147	COSMIC
COSN21882999	249	COSMIC
COSN31960075	394	COSMIC
COSN28663396	518	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1393064226	2	dbSNP
rs774074657	3	dbSNP
rs188567016	4	dbSNP
rs1355624751	6	dbSNP
rs771734245	7	dbSNP
rs1283532866	10	dbSNP
rs1315041225	15	dbSNP
rs773506979	17	dbSNP
rs761025577	21	dbSNP
rs751822701	22	dbSNP
rs900668174	24	dbSNP
rs777067942	25	dbSNP
rs1240232739	28	dbSNP
rs780786588	29	dbSNP
rs1158342383	31	dbSNP
rs1406514565	32	dbSNP
rs1416657379	35	dbSNP
rs374870407	37	dbSNP
rs1406196456	43	dbSNP
rs745674413	48	dbSNP
rs1199268091	58	dbSNP
rs1319919458	67	dbSNP
rs988805298	70	dbSNP
rs1293288568	77	dbSNP
rs998200100	78	dbSNP
rs1367996338	90	dbSNP
rs1276292947	94	dbSNP
rs192838481	95	dbSNP
rs1242365024	98	dbSNP
rs537237172	101	dbSNP
rs1039648872	104	dbSNP
rs1353291469	104	dbSNP
rs1170311325	108	dbSNP
rs1415442472	110	dbSNP
rs1427671850	116	dbSNP
rs886455159	119	dbSNP
rs1459926300	121	dbSNP
rs900653219	122	dbSNP
rs1238731211	127	dbSNP
rs932416342	129	dbSNP
rs1180602113	132	dbSNP
rs1419704405	142	dbSNP
rs1048185054	143	dbSNP
rs1362250554	145	dbSNP
rs1312614277	147	dbSNP
rs113719829	157	dbSNP
rs1231716125	159	dbSNP
rs963394544	160	dbSNP
rs1173521261	165	dbSNP
rs1448392791	177	dbSNP
rs185330105	179	dbSNP
rs1370496276	180	dbSNP
rs888170980	185	dbSNP
rs1298153841	190	dbSNP
rs188373137	199	dbSNP
rs1361332873	209	dbSNP
rs1172170414	216	dbSNP
rs1434428933	221	dbSNP
rs4464948	230	dbSNP
rs1417449650	231	dbSNP
rs1249886033	232	dbSNP
rs554215687	233	dbSNP
rs1483538118	238	dbSNP
rs1014171566	242	dbSNP
rs11547124	262	dbSNP
rs917820304	263	dbSNP
rs969853093	264	dbSNP
rs4478552	265	dbSNP
rs978536398	273	dbSNP
rs1240715956	287	dbSNP
rs1233610499	288	dbSNP
rs1262129158	290	dbSNP
rs1314675911	291	dbSNP
rs1321082186	294	dbSNP
rs1200339020	310	dbSNP
rs1396041628	312	dbSNP
rs966372074	318	dbSNP
rs139919223	319	dbSNP
rs956114177	326	dbSNP
rs1176672995	330	dbSNP
rs1361541659	334	dbSNP
rs1300338554	335	dbSNP
rs1248591663	337	dbSNP
rs1434983441	340	dbSNP
rs1363371364	346	dbSNP
rs1165583897	347	dbSNP
rs777709631	350	dbSNP
rs1419976031	351	dbSNP
rs1185670152	365	dbSNP
rs555035621	367	dbSNP
rs749528517	368	dbSNP
rs1206597904	369	dbSNP
rs770998009	377	dbSNP
rs974977345	378	dbSNP
rs376994588	382	dbSNP
rs922148579	383	dbSNP
rs922121784	384	dbSNP
rs933474274	388	dbSNP
rs1052464322	390	dbSNP
rs930814511	399	dbSNP
rs886653005	402	dbSNP
rs1298188070	411	dbSNP
rs1049217540	424	dbSNP
rs1802886	432	dbSNP
rs909642958	441	dbSNP
rs1392180516	443	dbSNP
rs576592915	444	dbSNP
rs939780698	445	dbSNP
rs1282194884	450	dbSNP
rs1392348377	464	dbSNP
rs1004845844	469	dbSNP
rs370125043	480	dbSNP
rs543973681	485	dbSNP
rs879270452	495	dbSNP
rs1226002811	497	dbSNP
rs1260646692	500	dbSNP
rs1210036269	502	dbSNP
rs1014616365	503	dbSNP
rs1044304437	505	dbSNP
rs1131075	507	dbSNP
rs565308459	516	dbSNP
rs905764619	517	dbSNP
rs532675568	518	dbSNP
rs1306841972	520	dbSNP
rs1131088	522	dbSNP
rs541280024	525	dbSNP
rs1267161520	530	dbSNP
rs980376608	539	dbSNP
rs1326179906	541	dbSNP
rs956357841	543	dbSNP
rs1443358158	545	dbSNP
rs1368952622	552	dbSNP
rs1489476872	555	dbSNP
rs1325307225	565	dbSNP
rs1466156648	567	dbSNP
rs1169537941	568	dbSNP
rs1460314078	569	dbSNP
rs1372269919	571	dbSNP
rs1199203003	572	dbSNP
rs1010302287	578	dbSNP
rs1223365357	581	dbSNP
rs558971110	589	dbSNP
rs966082735	592	dbSNP
rs1192487406	593	dbSNP
rs1457785853	601	dbSNP
rs1275765778	609	dbSNP
rs974717190	616	dbSNP
rs544277643	617	dbSNP
rs760503365	621	dbSNP

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.