miRTarBase - #MIRT452498


—
pre-miRNA Information
pre-miRNA hsa-mir-3179-1   
Genomic Coordinates chr16: 14901508 - 14901591
Description Homo sapiens miR-3179-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-2   
Genomic Coordinates chr16: 16300159 - 16300242
Description Homo sapiens miR-3179-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-3   
Genomic Coordinates chr16: 18411894 - 18411977
Description Homo sapiens miR-3179-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-4   
Genomic Coordinates chr16: 18494493 - 18494576
Description Homo sapiens miR-3179-4 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-3179
Sequence 52| AGAAGGGGUGAAAUUUAAACGU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1351100204 1 dbSNP
rs1398613616 4 dbSNP
rs1340262765 20 dbSNP
rs1229893475 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HMGXB3   
Synonyms HMGX3, SMF
Description HMG-box containing 3
Transcript NM_014983   
Expression
Putative miRNA Targets on HMGXB3
3'UTR of HMGXB3
(miRNA target sites are highlighted)		 
>HMGXB3|NM_014983|3'UTR
   1 GCCAGGCTGTTGTACAGGGACTACACCATCTCTCAAGCCATAGTAAGGCCCTTGCCTGAGGCAGAGCTATCCAGGGGACC
  81 TGCAGAAGTGGTCTCCTGTGGGGAGGGCCTCTGACTGCTGGGACTGACCAAAGAGCTTCCATTCCCTGAGCATGGTGGGA
 161 CCCAGGGTCCTCAGTTCTCAACCCTCCAGGGGTCAGGAGTGGTACCAGGAAACCTCTTCTGGCCCCGAGAGAGCACTTGG
 241 GGGACACGGTATGTTTAATGGAGGGGAGGCTGAGGGAAAGGCTCGTAGCTGGTGGGTTCCGTGGGGCCTGCGGTGTGGGT
 321 CAGGGTGGAGGTCCTGGGTGGGCTAAGGCGTGAGCCCCAGCACTAGGTGGGAAGGCTGCTGAGGTCTCTCCCACCCCTGA
 401 GGAGCCCTGGTTTCAGCCCCCTCAGTCTGATGAATTGCTTAGCCTGTTGCCTTTGACTAGGGGCCTGGGTGGCCTCATTA
 481 ACTCTAGGGGTCCCTTTGGGCTCTTGATTCTCCCTGAAGGAGGGATGCATTTCTCTCTTGCTCTTCCTGTACCCACATTT
 561 GGGGGAAGCTGAGGAGGGAGGAACAGTCAGCCACAGCTCTCTTCCAGCACTGTCCTCTCCACCCCAAGCTTTGAGGAAGA
 641 GCATCCCCTTCCTCCTTTCCCTGGCCACTGCTGCTGCAGCCAATATCCTCTCTGGGCCTGGGACCCTCTCCACAGAGGGG
 721 ATGTGGTCCCTGGTCATGACATAACCTAGCAGCAGTAGGAAAAACTCCCTTCTATGAAGGGGAAGCAGACTGGGCCATAA
 801 GGAAACAGCAGGACTGGCTCAAGTGCCCAAGGTTTGTTTAGGGCCTGGGAATTGGCCATGTGTTAATTTATTGAGTGGAG
 881 TAGGTGGCTTTTTTTCCCTCCCTCTTCCCCCAACAAGAATAAAGTTTATTAAATTATCTGGTTTTGGTGTAAAAAAAAAA
 961 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugcAAA---UUUAAAGU-GGGGAAGa 5'
             |||   :||   || ||||||| 
Target 5' agcTTTGAGGAAGAGCATCCCCTTCc 3'
 627 - 652 147.00 -14.60
2 
miRNA  3' ugcAAAUUUAAAG---UGGGGAAGa 5'
             |||   ||||    ||:|||| 
Target 5' gctTTT---TTTCCCTCCCTCTTCc 3'
 887 - 908 132.00 -8.90
3 
miRNA  3' ugcaaauuuaaagUGGGGAAGa 5'
                       |||:|||| 
Target 5' gtggtaccaggaaACCTCTTCt 3'
 199 - 220 129.00 -12.25
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31584092 11 COSMIC
COSN28724202 15 COSMIC
COSN22295756 44 COSMIC
COSN30092061 76 COSMIC
COSN31603718 86 COSMIC
COSN30177581 136 COSMIC
COSN14757726 285 COSMIC
COSN14732089 286 COSMIC
COSN14788524 313 COSMIC
COSN5592007 450 COSMIC
COSN17203719 533 COSMIC
COSN21914852 572 COSMIC
COSN20091282 589 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs914650061 2 dbSNP
rs1366856338 3 dbSNP
rs1363573997 4 dbSNP
rs968981560 10 dbSNP
rs377162827 11 dbSNP
rs1412309751 13 dbSNP
rs1424028392 14 dbSNP
rs117814799 15 dbSNP
rs1417058425 17 dbSNP
rs973228780 19 dbSNP
rs769965077 20 dbSNP
rs1408214627 21 dbSNP
rs1328489701 22 dbSNP
rs920400478 23 dbSNP
rs369898577 24 dbSNP
rs1285831278 25 dbSNP
rs1056727964 26 dbSNP
rs1261792080 27 dbSNP
rs986414867 27 dbSNP
rs1244518373 29 dbSNP
rs763199527 30 dbSNP
rs911812067 31 dbSNP
rs767450133 35 dbSNP
rs1193697269 39 dbSNP
rs1249434745 40 dbSNP
rs538348082 42 dbSNP
rs944740575 43 dbSNP
rs745821454 45 dbSNP
rs73796304 49 dbSNP
rs1241760777 50 dbSNP
rs892575142 51 dbSNP
rs189006398 52 dbSNP
rs1442953066 55 dbSNP
rs1176536823 57 dbSNP
rs1299978447 64 dbSNP
rs1374857892 67 dbSNP
rs565122218 68 dbSNP
rs1239679381 73 dbSNP
rs1480139710 74 dbSNP
rs1304509885 77 dbSNP
rs948380483 78 dbSNP
rs1037883360 79 dbSNP
rs216133 80 dbSNP
rs563134024 88 dbSNP
rs2569080 90 dbSNP
rs1043928826 93 dbSNP
rs369231982 99 dbSNP
rs1485183285 100 dbSNP
rs898894580 101 dbSNP
rs996093645 102 dbSNP
rs1277756422 103 dbSNP
rs1326186879 105 dbSNP
rs1047195103 109 dbSNP
rs773116625 110 dbSNP
rs1222547633 111 dbSNP
rs763772409 120 dbSNP
rs1297104310 122 dbSNP
rs1380399078 127 dbSNP
rs1384144062 136 dbSNP
rs1008526112 139 dbSNP
rs548572531 147 dbSNP
rs1235815899 148 dbSNP
rs1035718626 155 dbSNP
rs1019870287 158 dbSNP
rs1403694443 161 dbSNP
rs964070118 162 dbSNP
rs1480252319 167 dbSNP
rs1373655821 172 dbSNP
rs1195439941 175 dbSNP
rs79397030 176 dbSNP
rs1171205369 179 dbSNP
rs115654433 183 dbSNP
rs1462895188 186 dbSNP
rs762262575 186 dbSNP
rs968802345 188 dbSNP
rs181914877 189 dbSNP
rs35931468 189 dbSNP
rs1202568709 192 dbSNP
rs571418937 193 dbSNP
rs538402081 194 dbSNP
rs924428893 195 dbSNP
rs769178795 203 dbSNP
rs766625637 204 dbSNP
rs1380258186 214 dbSNP
rs1335851123 215 dbSNP
rs1446185900 217 dbSNP
rs1326782460 224 dbSNP
rs1373484266 225 dbSNP
rs775120153 227 dbSNP
rs953375571 227 dbSNP
rs184592217 228 dbSNP
rs1389685024 233 dbSNP
rs1164729055 237 dbSNP
rs1274022800 239 dbSNP
rs1339898382 241 dbSNP
rs754034806 242 dbSNP
rs965973776 244 dbSNP
rs988156595 248 dbSNP
rs959860814 249 dbSNP
rs1291914239 252 dbSNP
rs568778022 254 dbSNP
rs1043792032 258 dbSNP
rs1354838203 260 dbSNP
rs992736294 262 dbSNP
rs759701285 265 dbSNP
rs1337353283 266 dbSNP
rs915814284 269 dbSNP
rs926724825 272 dbSNP
rs1254431053 273 dbSNP
rs535871073 274 dbSNP
rs1056621335 276 dbSNP
rs1426688814 279 dbSNP
rs1383917539 280 dbSNP
rs373484017 281 dbSNP
rs386693508 284 dbSNP
rs879365603 284 dbSNP
rs216134 285 dbSNP
rs2116810 286 dbSNP
rs1035995707 287 dbSNP
rs1482528682 291 dbSNP
rs929033812 291 dbSNP
rs1268911979 295 dbSNP
rs897458004 296 dbSNP
rs1290907595 297 dbSNP
rs1039507667 299 dbSNP
rs1224321551 299 dbSNP
rs1277557962 301 dbSNP
rs1465127737 302 dbSNP
rs189230685 305 dbSNP
rs115765376 312 dbSNP
rs216135 313 dbSNP
rs1323416991 314 dbSNP
rs868416397 316 dbSNP
rs1401825206 317 dbSNP
rs1403797197 326 dbSNP
rs1387515723 332 dbSNP
rs1157207444 338 dbSNP
rs1472504246 348 dbSNP
rs147773951 350 dbSNP
rs530117984 351 dbSNP
rs1479157770 356 dbSNP
rs1245648252 367 dbSNP
rs1041344355 370 dbSNP
rs900062715 371 dbSNP
rs1448673082 375 dbSNP
rs114637510 380 dbSNP
rs1339772776 381 dbSNP
rs1284134099 384 dbSNP
rs1324048058 384 dbSNP
rs988024348 388 dbSNP
rs1233294495 394 dbSNP
rs1021592487 399 dbSNP
rs758961921 400 dbSNP
rs1353718464 402 dbSNP
rs1432040399 403 dbSNP
rs1347454140 407 dbSNP
rs1208852622 410 dbSNP
rs913909150 413 dbSNP
rs968080689 417 dbSNP
rs1407362672 418 dbSNP
rs1284573863 427 dbSNP
rs998987975 437 dbSNP
rs1467937802 438 dbSNP
rs1423783030 440 dbSNP
rs544780443 441 dbSNP
rs556914541 448 dbSNP
rs548223144 455 dbSNP
rs1240252474 457 dbSNP
rs1196329348 458 dbSNP
rs1261571490 461 dbSNP
rs566517408 464 dbSNP
rs1205731878 470 dbSNP
rs1310683386 473 dbSNP
rs1189337181 474 dbSNP
rs1370241577 487 dbSNP
rs938091710 490 dbSNP
rs1057048119 491 dbSNP
rs1162849402 500 dbSNP
rs992601218 501 dbSNP
rs141073864 510 dbSNP
rs1339112477 512 dbSNP
rs969915499 513 dbSNP
rs757666497 523 dbSNP
rs1170758515 531 dbSNP
rs1296121738 532 dbSNP
rs898742624 538 dbSNP
rs920315789 547 dbSNP
rs373193475 548 dbSNP
rs1167837677 550 dbSNP
rs1445168371 551 dbSNP
rs181640358 555 dbSNP
rs1314828592 560 dbSNP
rs888878611 563 dbSNP
rs1007283969 566 dbSNP
rs1237091913 573 dbSNP
rs779904439 578 dbSNP
rs1309282184 581 dbSNP
rs1491321345 583 dbSNP
rs1360775050 584 dbSNP
rs1491164070 584 dbSNP
rs527830867 587 dbSNP
rs983250298 588 dbSNP
rs911626354 589 dbSNP
rs1009402855 591 dbSNP
rs1298345984 593 dbSNP
rs1284303885 595 dbSNP
rs1488194180 597 dbSNP
rs866836877 599 dbSNP
rs748970816 600 dbSNP
rs1041207105 603 dbSNP
rs967944771 604 dbSNP
rs979452252 608 dbSNP
rs1408475077 609 dbSNP
rs768384471 610 dbSNP
rs778498240 612 dbSNP
rs1204513553 616 dbSNP
rs186757111 619 dbSNP
rs1294555029 621 dbSNP
rs772112391 630 dbSNP
rs564385267 632 dbSNP
rs1321455472 640 dbSNP
rs1308164933 645 dbSNP
rs1043698878 646 dbSNP
rs1348229459 646 dbSNP
rs904556751 648 dbSNP
rs992216462 651 dbSNP
rs917991157 655 dbSNP
rs940225344 658 dbSNP
rs999247021 664 dbSNP
rs1345500467 666 dbSNP
rs1186949580 670 dbSNP
rs1364532933 671 dbSNP
rs1031738820 673 dbSNP
rs972861164 675 dbSNP
rs571046603 678 dbSNP
rs920199480 679 dbSNP
rs1181785099 680 dbSNP
rs1480774421 681 dbSNP
rs1441775719 683 dbSNP
rs1208505227 684 dbSNP
rs931539014 687 dbSNP
rs1049214704 689 dbSNP
rs1327579888 693 dbSNP
rs1267075771 694 dbSNP
rs895879766 695 dbSNP
rs1346808102 696 dbSNP
rs1298568240 697 dbSNP
rs538020108 700 dbSNP
rs532191160 703 dbSNP
rs1290599721 707 dbSNP
rs1435150874 710 dbSNP
rs1022715994 711 dbSNP
rs1304479025 714 dbSNP
rs191442868 716 dbSNP
rs1470427867 719 dbSNP
rs1431465811 721 dbSNP
rs142986065 724 dbSNP
rs1394890034 727 dbSNP
rs1263006176 734 dbSNP
rs556824092 737 dbSNP
rs1267932678 742 dbSNP
rs1203840190 745 dbSNP
rs969864556 746 dbSNP
rs973381043 747 dbSNP
rs746852239 753 dbSNP
rs1370171604 757 dbSNP
rs1378544905 759 dbSNP
rs1471749922 760 dbSNP
rs950437835 763 dbSNP
rs1307618255 767 dbSNP
rs1237473611 773 dbSNP
rs1297569181 779 dbSNP
rs1432845498 782 dbSNP
rs943116609 785 dbSNP
rs181134438 786 dbSNP
rs112744104 788 dbSNP
rs1404612576 794 dbSNP
rs1171080370 795 dbSNP
rs944404198 797 dbSNP
rs1465589587 809 dbSNP
rs1235508296 812 dbSNP
rs976920656 815 dbSNP
rs770733464 816 dbSNP
rs1247737140 818 dbSNP
rs932804988 819 dbSNP
rs568846182 821 dbSNP
rs1020782549 824 dbSNP
rs1258224561 828 dbSNP
rs903791327 831 dbSNP
rs1199544038 837 dbSNP
rs529928112 838 dbSNP
rs1200456049 841 dbSNP
rs904753302 845 dbSNP
rs1226006913 847 dbSNP
rs1034099560 854 dbSNP
rs1062069 859 dbSNP
rs1315723754 860 dbSNP
rs540746266 863 dbSNP
rs1332381059 868 dbSNP
rs992559617 873 dbSNP
rs566465356 874 dbSNP
rs1053018491 877 dbSNP
rs1397224607 882 dbSNP
rs961422257 885 dbSNP
rs1427972427 887 dbSNP
rs920062108 889 dbSNP
rs972892234 889 dbSNP
rs186154097 891 dbSNP
rs931576286 894 dbSNP
rs895909088 895 dbSNP
rs1014333224 896 dbSNP
rs765660107 896 dbSNP
rs943084987 897 dbSNP
rs1202399896 899 dbSNP
rs1375797327 900 dbSNP
rs1040432684 906 dbSNP
rs1465469996 907 dbSNP
rs558633316 909 dbSNP
rs1224664289 911 dbSNP
rs1168469270 912 dbSNP
rs1353944375 920 dbSNP
rs1283387241 923 dbSNP
rs1336567896 926 dbSNP
rs151112573 926 dbSNP
rs1290518723 927 dbSNP
rs1370047770 928 dbSNP
rs1443970351 928 dbSNP
rs538467050 928 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcaaauuuaaaGU-GGGGAAGa 5'
                      || ||||||| 
Target 5' ------------CAUCCCCUUCc 3'
 		1 - 11
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000503427.1 | 3UTR | CAUCCCCUUCCUCCUUUCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
133 hsa-miR-3179 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102087 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT110061 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 6
MIRT112198 BTG2 BTG anti-proliferation factor 2 2 2
MIRT117668 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT146657 MINK1 misshapen like kinase 1 2 2
MIRT175505 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT180535 TXNIP thioredoxin interacting protein 2 2
MIRT190624 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190650 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT366902 NONO non-POU domain containing octamer binding 2 2
MIRT443554 ZFP3 ZFP3 zinc finger protein 2 2
MIRT445953 MLLT11 MLLT11, transcription factor 7 cofactor 2 2
MIRT446042 HMCN1 hemicentin 1 2 2
MIRT447968 MSH6 mutS homolog 6 2 2
MIRT448634 ONECUT1 one cut homeobox 1 2 2
MIRT449316 MRO maestro 2 2
MIRT451380 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451547 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451807 CDCA3 cell division cycle associated 3 2 4
MIRT451916 ILK integrin linked kinase 2 2
MIRT451938 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452189 KIAA1456 KIAA1456 2 2
MIRT452498 HMGXB3 HMG-box containing 3 2 2
MIRT452548 ZNF467 zinc finger protein 467 2 2
MIRT453844 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT454515 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT455363 KDM5C lysine demethylase 5C 2 2
MIRT455455 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455628 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 10
MIRT455639 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 10
MIRT455690 GLO1 glyoxalase I 2 2
MIRT456300 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT456784 MTHFSD methenyltetrahydrofolate synthetase domain containing 2 2
MIRT456819 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457566 ZNF34 zinc finger protein 34 2 2
MIRT457604 IDS iduronate 2-sulfatase 2 2
MIRT458236 NXPH3 neurexophilin 3 2 2
MIRT458313 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458350 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458670 GPR35 G protein-coupled receptor 35 2 2
MIRT459675 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT461126 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461918 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462301 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT463520 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT464378 URM1 ubiquitin related modifier 1 2 2
MIRT464614 UBE4B ubiquitination factor E4B 2 2
MIRT464711 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465520 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465974 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466058 TMEM189 transmembrane protein 189 2 2
MIRT466548 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT466647 TAGLN2 transgelin 2 2 2
MIRT467357 SP2 Sp2 transcription factor 2 2
MIRT468744 SDC2 syndecan 2 2 2
MIRT470244 PRRC2A proline rich coiled-coil 2A 2 2
MIRT471426 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471732 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472190 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472450 NAV2 neuron navigator 2 2 6
MIRT474563 KLHDC3 kelch domain containing 3 2 2
MIRT474936 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475165 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475399 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT475426 ICK intestinal cell kinase 2 2
MIRT477090 FAM168A family with sequence similarity 168 member A 2 2
MIRT478458 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478953 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480096 CALR calreticulin 2 2
MIRT481924 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT483217 APOA1 apolipoprotein A1 2 6
MIRT483882 TGIF1 TGFB induced factor homeobox 1 2 2
MIRT483923 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 2
MIRT483942 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484209 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484512 SYT7 synaptotagmin 7 2 2
MIRT484709 RNF11 ring finger protein 11 2 2
MIRT485356 MYO1C myosin IC 2 4
MIRT485615 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT486584 ZNF619 zinc finger protein 619 2 2
MIRT487013 C2orf82 chromosome 2 open reading frame 82 2 2
MIRT487621 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487801 GPR20 G protein-coupled receptor 20 2 4
MIRT488134 GPR107 G protein-coupled receptor 107 2 2
MIRT488773 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT488854 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489783 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490102 FN3K fructosamine 3 kinase 2 2
MIRT490389 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490434 MYL9 myosin light chain 9 2 2
MIRT490451 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490880 OSBP oxysterol binding protein 2 2
MIRT491037 ALPK3 alpha kinase 3 2 2
MIRT491250 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491748 SEMA3F semaphorin 3F 2 2
MIRT492235 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492490 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492505 RANBP10 RAN binding protein 10 2 4
MIRT492773 PDGFB platelet derived growth factor subunit B 2 2
MIRT492922 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT493459 ITFG3 family with sequence similarity 234 member A 2 2
MIRT493654 HDLBP high density lipoprotein binding protein 2 2
MIRT494011 DUSP9 dual specificity phosphatase 9 2 2
MIRT499412 PLCG2 phospholipase C gamma 2 2 4
MIRT499552 C15orf43 telomere repeat binding bouquet formation protein 2 2 2
MIRT501836 NCOA2 nuclear receptor coactivator 2 2 2
MIRT501950 MAT2A methionine adenosyltransferase 2A 2 10
MIRT504066 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT504509 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT508466 HOXB6 homeobox B6 2 4
MIRT512373 CPM carboxypeptidase M 2 2
MIRT513578 EVX1 even-skipped homeobox 1 2 2
MIRT517763 ZNF366 zinc finger protein 366 2 4
MIRT519773 ZNF354B zinc finger protein 354B 2 8
MIRT523568 GGCX gamma-glutamyl carboxylase 2 4
MIRT532802 CLDN11 claudin 11 2 2
MIRT544299 TSPYL1 TSPY like 1 2 2
MIRT544862 MYH2 myosin heavy chain 2 2 4
MIRT556731 KLHL15 kelch like family member 15 2 4
MIRT564347 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568924 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT569012 CXorf36 chromosome X open reading frame 36 2 2
MIRT569256 FAM129B family with sequence similarity 129 member B 2 2
MIRT569591 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT569779 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT570034 FAM228A family with sequence similarity 228 member A 2 2
MIRT573803 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574190 ZNF264 zinc finger protein 264 2 2
MIRT576153 Hmox1 heme oxygenase 1 2 2
MIRT611311 CA8 carbonic anhydrase 8 2 4
MIRT673429 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT674976 SH3BP2 SH3 domain binding protein 2 2 2
MIRT692712 MEAF6 MYST/Esa1 associated factor 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3179 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission