>ZFP69B|NM_023070|3'UTR
   1 AATATACTAAACATCAAAGAATCTATGTTGGAGCACAAGATTCTAAATCAGTGGTTCCCTGATCCCTCAAAAATCCATTT
  81 GTTTTTGGATTTCCAAAAACGAACATTAAAAAAAAATGGTTTGGCACAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugaCGUC--GGAACUGGAGGGUc 5' |::| || |||:| |:|| Target 5' tcaGTGGTTCCCTGATCCCTCAa 3'	48 - 70	100.00	-11.00
2	miRNA 3' ugACGUCGGAACUGGAGGGUc 5' | :: ::|||: :|:||| Target 5' caTTTGTTTTTGGATTTCCAa 3'	76 - 96	95.00	-9.50
3	miRNA 3' ugacgucggaacuggAGGGUc 5' |:|:| Target 5' tgttggagcacaagaTTCTAa 3'	26 - 46	68.00	-7.60

Mutant ID	Mutant Position	Mutant Source
COSN31520234	20	COSMIC
COSN31960222	24	COSMIC
COSN31502460	35	COSMIC
COSN18724394	117	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs779289331	7	dbSNP
rs1281348423	8	dbSNP
rs573955260	14	dbSNP
rs376819093	16	dbSNP
rs563243981	18	dbSNP
rs369233223	21	dbSNP
rs373995561	24	dbSNP
rs780991567	26	dbSNP
rs747927411	27	dbSNP
rs576338064	29	dbSNP
rs1055604	44	dbSNP
rs1444186708	46	dbSNP
rs913379108	49	dbSNP
rs920897956	50	dbSNP
rs950227377	69	dbSNP
rs1045922962	74	dbSNP
rs1458125714	77	dbSNP
rs1428998307	80	dbSNP
rs932393347	83	dbSNP
rs749336363	101	dbSNP
rs1426406769	102	dbSNP
rs1055188419	108	dbSNP
rs1484904322	108	dbSNP
rs1274319097	109	dbSNP
rs1250166706	118	dbSNP
rs192686781	126	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.