pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-628 |
Genomic Coordinates | chr15: 55372940 - 55373034 |
Synonyms | MIRN628, hsa-mir-628, MIR628 |
Description | Homo sapiens miR-628 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-628-3p | ||||||||||||||||||||||||||||
Sequence | 61| UCUAGUAAGAGUGGCAGUCGA |81 | ||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||
Experiments | Microarray | ||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
DRVs in miRNA |
|
||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | REPIN1 | ||||||||||||||||||||
Synonyms | AP4, RIP60, ZNF464, Zfp464 | ||||||||||||||||||||
Description | replication initiator 1 | ||||||||||||||||||||
Transcript | NM_001099695 | ||||||||||||||||||||
Other Transcripts | NM_001099696 , NM_013400 , NM_014374 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on REPIN1 | |||||||||||||||||||||
3'UTR of REPIN1 (miRNA target sites are highlighted) |
>REPIN1|NM_001099695|3'UTR 1 GACGGTGGGCGGGGCCGTGTTGGCTGAGAGAGGGCTGGGGTCCTTCGTGGTGGGAGTCGCAGTGGGCTGGGGGTGCCTGC 81 CTAGTGCTGGAGTAGGGGACAATGGGAATCCTAGAGGGGATGGAAGACGCGGGGAGTGAGCTGGGTGGGCCCTGCTAGCG 161 AGAGAGGTCAACCCCGGTGGCCAGGGAACCCACTTCCAAGCGCAGGGACGCCGGCCTCCAGCTGGTGTGTGCTAAGGCTC 241 CGTCCTGACTGCCCTGTGCCCTGGAAAAGCAGCAATAGCATCCGCCCCTTAGAGCCCTCTGGCTAGAGGAGCCACCAGTG 321 GAAAGGAAGACCCTCCATCCTCTGGTATTAACGCCTTAATGCCCCTGTCTTTTACTGTAAGTTACTTAAGATCATTTTTG 401 GAAGCAGGCGTGGTAGAGTCCTGTAAATGAATGCTCTGGGCTAGATACAGCTTGGAGAACCTGCTGGCCTTGTTAGACAG 481 CACTTGGGCCTTTGCCAGCAGCAAGAGGTGAAGCGAAGCCACTCTTACCTCTCCCTTCCCCTCCCACCTGCCCCCTGCGT 561 AGGCACCCAGACTTGGAGAGACCCGTCTGCTGTTAATACTTCCATCCTCTTCCTTCCCAAAGAGCAGATCCCAAGGCATT 641 TACTCCTTGGTCTGTCTCGCTTTATCTGTCGCCCCTCCCAGCGCTGAGAGCCTCCCCTGGCTGTCAGCAGCACTGTGTCC 721 AGGCTCTTGTCTGAACACCGCAGCCCCTCCTTCGCTCCTTCCAGAGCTCAGCATGTCACGGCAAGGACTGCCGCATTGGT 801 GATGGAGGGCCAGCTGAGGGGAAGTTGCTGGTGAGTTTCCTTTTCTCCATTTCTAGCATATGGACACCTGGCCTCTGCTT 881 GAGCACTTAGGTGACAGGAACTTCCGCACCTCCTGAGGCCCTGGATGATTCTAATTGTTAGAAATTCTAATTGTTAGAAA 961 TCCTTCCTTATAATGAATGAATTCTGCTTTCCTATAATTTCTACCTATTGGGCCTTGTTCTGTTCTCTGGAACTAAACAG 1041 AACAACCATTTACCCCTCCTTTTCAAACTAGAGAATAAAGATTTGGTTTTAGAACTGGTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000479668.1 | 3UTR | CCACUCUUACCUCUCCCUUCCCCUCCCACCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
27 hsa-miR-628-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT039584 | CDC14A | cell division cycle 14A | 1 | 1 | ||||||||
MIRT039585 | AGO1 | argonaute 1, RISC catalytic component | 2 | 3 | ||||||||
MIRT039586 | TGFBRAP1 | transforming growth factor beta receptor associated protein 1 | 1 | 1 | ||||||||
MIRT039587 | LRP6 | LDL receptor related protein 6 | 1 | 1 | ||||||||
MIRT071876 | BTF3L4 | basic transcription factor 3 like 4 | 2 | 2 | ||||||||
MIRT097443 | JMY | junction mediating and regulatory protein, p53 cofactor | 2 | 4 | ||||||||
MIRT100100 | ABT1 | activator of basal transcription 1 | 2 | 8 | ||||||||
MIRT147692 | CBX4 | chromobox 4 | 2 | 2 | ||||||||
MIRT408248 | PURA | purine rich element binding protein A | 2 | 2 | ||||||||
MIRT442047 | LRAT | lecithin retinol acyltransferase | 2 | 2 | ||||||||
MIRT444412 | RAB3IP | RAB3A interacting protein | 2 | 2 | ||||||||
MIRT452599 | REPIN1 | replication initiator 1 | 2 | 2 | ||||||||
MIRT469515 | RBFOX2 | RNA binding protein, fox-1 homolog 2 | 2 | 8 | ||||||||
MIRT498192 | AKR1B10 | aldo-keto reductase family 1 member B10 | 2 | 2 | ||||||||
MIRT500151 | CREBBP | CREB binding protein | 2 | 2 | ||||||||
MIRT507319 | FAM60A | SIN3-HDAC complex associated factor | 2 | 6 | ||||||||
MIRT508343 | ZNF273 | zinc finger protein 273 | 2 | 6 | ||||||||
MIRT520480 | TRIM13 | tripartite motif containing 13 | 2 | 2 | ||||||||
MIRT522461 | MMP16 | matrix metallopeptidase 16 | 2 | 4 | ||||||||
MIRT547116 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | 2 | 2 | ||||||||
MIRT548675 | CRNKL1 | crooked neck pre-mRNA splicing factor 1 | 2 | 2 | ||||||||
MIRT553756 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | 2 | 4 | ||||||||
MIRT559437 | ARSJ | arylsulfatase family member J | 2 | 2 | ||||||||
MIRT610490 | GPC4 | glypican 4 | 2 | 2 | ||||||||
MIRT644682 | TMCO1 | transmembrane and coiled-coil domains 1 | 2 | 2 | ||||||||
MIRT658214 | FBXO21 | F-box protein 21 | 2 | 2 | ||||||||
MIRT756083 | TP53 | tumor protein p53 | 4 | 1 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|