miRTarBase - #MIRT452615


—
pre-miRNA Information
pre-miRNA hsa-mir-7515   
Genomic Coordinates chr2: 6650373 - 6650439
Description Homo sapiens miR-7515 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7515
Sequence 46| AGAAGGGAAGAUGGUGAC |63
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1451879371 1 dbSNP
rs576086800 3 dbSNP
rs753372632 5 dbSNP
rs1337497055 7 dbSNP
rs1405449301 9 dbSNP
rs1032296398 10 dbSNP
rs960195576 12 dbSNP
rs1470711310 14 dbSNP
Putative Targets

Gene Information
Gene Symbol REPIN1   
Synonyms AP4, RIP60, ZNF464, Zfp464
Description replication initiator 1
Transcript NM_001099695   
Other Transcripts NM_001099696 , NM_013400 , NM_014374   
Expression
Putative miRNA Targets on REPIN1
3'UTR of REPIN1
(miRNA target sites are highlighted)		 
>REPIN1|NM_001099695|3'UTR
   1 GACGGTGGGCGGGGCCGTGTTGGCTGAGAGAGGGCTGGGGTCCTTCGTGGTGGGAGTCGCAGTGGGCTGGGGGTGCCTGC
  81 CTAGTGCTGGAGTAGGGGACAATGGGAATCCTAGAGGGGATGGAAGACGCGGGGAGTGAGCTGGGTGGGCCCTGCTAGCG
 161 AGAGAGGTCAACCCCGGTGGCCAGGGAACCCACTTCCAAGCGCAGGGACGCCGGCCTCCAGCTGGTGTGTGCTAAGGCTC
 241 CGTCCTGACTGCCCTGTGCCCTGGAAAAGCAGCAATAGCATCCGCCCCTTAGAGCCCTCTGGCTAGAGGAGCCACCAGTG
 321 GAAAGGAAGACCCTCCATCCTCTGGTATTAACGCCTTAATGCCCCTGTCTTTTACTGTAAGTTACTTAAGATCATTTTTG
 401 GAAGCAGGCGTGGTAGAGTCCTGTAAATGAATGCTCTGGGCTAGATACAGCTTGGAGAACCTGCTGGCCTTGTTAGACAG
 481 CACTTGGGCCTTTGCCAGCAGCAAGAGGTGAAGCGAAGCCACTCTTACCTCTCCCTTCCCCTCCCACCTGCCCCCTGCGT
 561 AGGCACCCAGACTTGGAGAGACCCGTCTGCTGTTAATACTTCCATCCTCTTCCTTCCCAAAGAGCAGATCCCAAGGCATT
 641 TACTCCTTGGTCTGTCTCGCTTTATCTGTCGCCCCTCCCAGCGCTGAGAGCCTCCCCTGGCTGTCAGCAGCACTGTGTCC
 721 AGGCTCTTGTCTGAACACCGCAGCCCCTCCTTCGCTCCTTCCAGAGCTCAGCATGTCACGGCAAGGACTGCCGCATTGGT
 801 GATGGAGGGCCAGCTGAGGGGAAGTTGCTGGTGAGTTTCCTTTTCTCCATTTCTAGCATATGGACACCTGGCCTCTGCTT
 881 GAGCACTTAGGTGACAGGAACTTCCGCACCTCCTGAGGCCCTGGATGATTCTAATTGTTAGAAATTCTAATTGTTAGAAA
 961 TCCTTCCTTATAATGAATGAATTCTGCTTTCCTATAATTTCTACCTATTGGGCCTTGTTCTGTTCTCTGGAACTAAACAG
1041 AACAACCATTTACCCCTCCTTTTCAAACTAGAGAATAAAGATTTGGTTTTAGAACTGGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' caGUGGUAGAAGGGAAGa 5'
            :||| || ||||||| 
Target 5' ctTACC-TC-TCCCTTCc 3'
 524 - 539 150.00 -15.80
2 
miRNA  3' caGUGGUAGAAGGGAAGa 5'
            ||:| || |:||||| 
Target 5' tcCATCCTC-TTCCTTCc 3'
 601 - 617 139.00 -13.40
3 
miRNA  3' cagUGGUAGA-----AGGGAAGa 5'
             |||||:|     |||:||: 
Target 5' acaACCATTTACCCCTCCTTTTc 3'
 1042 - 1064 123.00 -12.44
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5853211 4 COSMIC
COSN30150870 5 COSMIC
COSN30478190 5 COSMIC
COSN31511209 11 COSMIC
COSN30501397 21 COSMIC
COSN30479150 27 COSMIC
COSN30518414 27 COSMIC
COSN19212826 59 COSMIC
COSN30108764 79 COSMIC
COSN15626115 111 COSMIC
COSN30510479 120 COSMIC
COSN31590436 130 COSMIC
COSN30133861 132 COSMIC
COSN31550540 145 COSMIC
COSN31778617 157 COSMIC
COSN31595313 181 COSMIC
COSN26556287 187 COSMIC
COSN31589541 202 COSMIC
COSN31542709 203 COSMIC
COSN22165177 241 COSMIC
COSN21701199 242 COSMIC
COSN25145949 264 COSMIC
COSN5651723 367 COSMIC
COSN30143484 421 COSMIC
COSN30529793 427 COSMIC
COSN30143121 490 COSMIC
COSN30510069 507 COSMIC
COSN21765485 552 COSMIC
COSN28741561 597 COSMIC
COSN28821792 630 COSMIC
COSN30531795 652 COSMIC
COSN30544093 772 COSMIC
COSN28821203 781 COSMIC
COSN31482096 783 COSMIC
COSN26552047 794 COSMIC
COSN30530678 820 COSMIC
COSN24302132 857 COSMIC
COSN30136282 962 COSMIC
COSN30112341 980 COSMIC
COSN9936614 1005 COSMIC
COSN31490790 1044 COSMIC
COSN31596646 1088 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1380067767 2 dbSNP
rs765174380 4 dbSNP
rs752590604 7 dbSNP
rs761921076 12 dbSNP
rs1281708597 15 dbSNP
rs767610161 18 dbSNP
rs1311996985 21 dbSNP
rs1239981165 26 dbSNP
rs1262753903 27 dbSNP
rs1484919365 31 dbSNP
rs1216054389 33 dbSNP
rs750666548 34 dbSNP
rs1420544708 37 dbSNP
rs1490474675 39 dbSNP
rs1201523129 42 dbSNP
rs1264946095 44 dbSNP
rs756351072 45 dbSNP
rs1023759899 50 dbSNP
rs1159340452 51 dbSNP
rs1181595883 54 dbSNP
rs1487192675 59 dbSNP
rs1471676696 62 dbSNP
rs1234512847 69 dbSNP
rs551774111 72 dbSNP
rs568786439 74 dbSNP
rs907499331 75 dbSNP
rs1212425220 102 dbSNP
rs116293076 103 dbSNP
rs554480290 111 dbSNP
rs73474368 112 dbSNP
rs534041526 118 dbSNP
rs1215108791 119 dbSNP
rs899106310 121 dbSNP
rs183206903 123 dbSNP
rs1226005755 124 dbSNP
rs961330211 126 dbSNP
rs1417727264 128 dbSNP
rs972941907 131 dbSNP
rs573297366 136 dbSNP
rs919762643 137 dbSNP
rs890324662 139 dbSNP
rs780101097 142 dbSNP
rs545392240 149 dbSNP
rs558970006 150 dbSNP
rs1324326298 151 dbSNP
rs1463176523 168 dbSNP
rs1395461565 170 dbSNP
rs1428171894 172 dbSNP
rs1165685602 174 dbSNP
rs575742388 182 dbSNP
rs1459912379 184 dbSNP
rs761453488 184 dbSNP
rs1008943576 185 dbSNP
rs910998536 186 dbSNP
rs1177643973 189 dbSNP
rs1325215966 190 dbSNP
rs1389270645 195 dbSNP
rs1477662385 196 dbSNP
rs1257083266 203 dbSNP
rs1031511932 204 dbSNP
rs1437117507 210 dbSNP
rs956703349 213 dbSNP
rs1195300257 218 dbSNP
rs1360965119 222 dbSNP
rs377426608 233 dbSNP
rs1314411084 250 dbSNP
rs1040729694 254 dbSNP
rs1332088728 259 dbSNP
rs561612183 262 dbSNP
rs969613960 265 dbSNP
rs530186400 267 dbSNP
rs1284364061 268 dbSNP
rs928116765 276 dbSNP
rs1054487905 284 dbSNP
rs1301940154 287 dbSNP
rs188141580 300 dbSNP
rs948233277 302 dbSNP
rs191964359 303 dbSNP
rs1320140998 305 dbSNP
rs907630653 306 dbSNP
rs1346977183 319 dbSNP
rs1159948686 320 dbSNP
rs1413794891 336 dbSNP
rs1393158974 337 dbSNP
rs879228245 346 dbSNP
rs1211078840 350 dbSNP
rs940345152 351 dbSNP
rs1485732666 356 dbSNP
rs1184346501 365 dbSNP
rs1182702009 366 dbSNP
rs1486656625 394 dbSNP
rs1242150813 401 dbSNP
rs1037312295 406 dbSNP
rs906632885 411 dbSNP
rs3192130 413 dbSNP
rs1237234305 417 dbSNP
rs1348962012 427 dbSNP
rs931895699 446 dbSNP
rs551884072 447 dbSNP
rs1164320716 448 dbSNP
rs1364383883 450 dbSNP
rs1014932531 451 dbSNP
rs1289709731 473 dbSNP
rs1447359580 478 dbSNP
rs768516226 482 dbSNP
rs1458784116 483 dbSNP
rs1314639625 490 dbSNP
rs897021870 503 dbSNP
rs1156782072 506 dbSNP
rs1344442902 515 dbSNP
rs994095840 516 dbSNP
rs774189227 526 dbSNP
rs1168096957 527 dbSNP
rs1448446831 529 dbSNP
rs1304300766 530 dbSNP
rs1353189819 533 dbSNP
rs375821873 533 dbSNP
rs890260300 536 dbSNP
rs1009160412 541 dbSNP
rs1052503991 545 dbSNP
rs1486296627 552 dbSNP
rs568498431 553 dbSNP
rs1288459617 560 dbSNP
rs1026891602 561 dbSNP
rs952533991 562 dbSNP
rs1309682645 567 dbSNP
rs1296544685 574 dbSNP
rs892525096 575 dbSNP
rs761570199 583 dbSNP
rs1353568209 586 dbSNP
rs1330542541 588 dbSNP
rs1051760 597 dbSNP
rs1051764 630 dbSNP
rs1316765242 632 dbSNP
rs1369841624 639 dbSNP
rs969418059 650 dbSNP
rs1463322931 655 dbSNP
rs965167043 656 dbSNP
rs184568102 665 dbSNP
rs960879533 669 dbSNP
rs1419323594 670 dbSNP
rs760702502 671 dbSNP
rs1471999755 672 dbSNP
rs1250404223 680 dbSNP
rs1481821246 681 dbSNP
rs983373547 684 dbSNP
rs923628099 691 dbSNP
rs908734597 703 dbSNP
rs935027674 708 dbSNP
rs1333005743 715 dbSNP
rs989737453 723 dbSNP
rs1233954753 729 dbSNP
rs973162033 731 dbSNP
rs1350017567 735 dbSNP
rs533709234 740 dbSNP
rs915521351 742 dbSNP
rs553953335 746 dbSNP
rs948178014 754 dbSNP
rs1473594403 755 dbSNP
rs1045270143 756 dbSNP
rs1396178816 757 dbSNP
rs985981669 765 dbSNP
rs911816497 769 dbSNP
rs906580272 774 dbSNP
rs1361628207 780 dbSNP
rs1051823 781 dbSNP
rs568607326 794 dbSNP
rs1251640199 796 dbSNP
rs543350624 806 dbSNP
rs1467455888 808 dbSNP
rs1255110917 810 dbSNP
rs1177986685 811 dbSNP
rs995275225 820 dbSNP
rs753150848 821 dbSNP
rs758877529 822 dbSNP
rs946779412 840 dbSNP
rs1302629599 845 dbSNP
rs1438410413 848 dbSNP
rs1372984773 853 dbSNP
rs1043837892 859 dbSNP
rs753749104 861 dbSNP
rs1433911174 865 dbSNP
rs752672882 877 dbSNP
rs1351854493 890 dbSNP
rs536005303 895 dbSNP
rs1159828677 904 dbSNP
rs559132783 905 dbSNP
rs1364859501 906 dbSNP
rs1018066578 919 dbSNP
rs1173626828 927 dbSNP
rs1278363823 928 dbSNP
rs371626146 928 dbSNP
rs965628555 933 dbSNP
rs575704271 936 dbSNP
rs1446664256 937 dbSNP
rs760061449 950 dbSNP
rs1259691673 964 dbSNP
rs1206936054 968 dbSNP
rs976523529 971 dbSNP
rs1373253305 972 dbSNP
rs1220260184 984 dbSNP
rs1349696006 987 dbSNP
rs765732778 993 dbSNP
rs189325156 998 dbSNP
rs1324290013 1001 dbSNP
rs1319936753 1003 dbSNP
rs1346117575 1005 dbSNP
rs956382460 1007 dbSNP
rs1004498391 1009 dbSNP
rs14356 1014 dbSNP
rs1275590409 1015 dbSNP
rs11764897 1029 dbSNP
rs575090642 1035 dbSNP
rs540446106 1041 dbSNP
rs192583157 1049 dbSNP
rs115575718 1052 dbSNP
rs1377605927 1054 dbSNP
rs1232321610 1059 dbSNP
rs1174686578 1068 dbSNP
rs1475312693 1071 dbSNP
rs948291741 1082 dbSNP
rs980894583 1083 dbSNP
rs928148818 1087 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' caGUGGUAGAAGGGAAGa 5'
            :||| || ||||||| 
Target 5' cuUACC-UC-UCCCUUCc 3'
 		6 - 21
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000479668.1 | 3UTR | CCACUCUUACCUCUCCCUUCCCCUCCCACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
116 hsa-miR-7515 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT063460 SKI SKI proto-oncogene 2 4
MIRT089615 MAT2A methionine adenosyltransferase 2A 2 10
MIRT100238 PRR3 proline rich 3 2 4
MIRT159239 NRBP1 nuclear receptor binding protein 1 2 2
MIRT183526 BTG2 BTG anti-proliferation factor 2 2 2
MIRT266866 SLC25A44 solute carrier family 25 member 44 2 2
MIRT304116 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 4
MIRT331077 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT350659 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT438442 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT443555 ZFP3 ZFP3 zinc finger protein 2 2
MIRT447969 MSH6 mutS homolog 6 2 2
MIRT448635 ONECUT1 one cut homeobox 1 2 2
MIRT451778 USP36 ubiquitin specific peptidase 36 2 2
MIRT452615 REPIN1 replication initiator 1 2 2
MIRT453433 GLG1 golgi glycoprotein 1 2 2
MIRT454015 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT454961 TPM2 tropomyosin 2 2 2
MIRT455364 KDM5C lysine demethylase 5C 2 2
MIRT455434 ID3 inhibitor of DNA binding 3, HLH protein 2 2
MIRT455456 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455595 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT455689 GLO1 glyoxalase I 2 2
MIRT455949 CYP4A22 cytochrome P450 family 4 subfamily A member 22 2 2
MIRT456135 SAMD10 sterile alpha motif domain containing 10 2 2
MIRT456821 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457441 NOL10 nucleolar protein 10 2 2
MIRT458048 TSEN54 tRNA splicing endonuclease subunit 54 2 2
MIRT458237 NXPH3 neurexophilin 3 2 2
MIRT458671 GPR35 G protein-coupled receptor 35 2 2
MIRT458741 CES2 carboxylesterase 2 2 2
MIRT459102 CYP4A11 cytochrome P450 family 4 subfamily A member 11 2 2
MIRT459676 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459776 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT461975 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462267 TPI1 triosephosphate isomerase 1 2 2
MIRT463296 ZFP91 ZFP91 zinc finger protein 2 2
MIRT463446 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT464379 URM1 ubiquitin related modifier 1 2 2
MIRT465552 TOB2 transducer of ERBB2, 2 2 2
MIRT467359 SP2 Sp2 transcription factor 2 2
MIRT467638 SLC7A5 solute carrier family 7 member 5 2 2
MIRT467795 SLC2A14 solute carrier family 2 member 14 2 2
MIRT468466 SET SET nuclear proto-oncogene 2 4
MIRT468725 SDC4 syndecan 4 2 2
MIRT468784 SCAMP5 secretory carrier membrane protein 5 2 2
MIRT469154 RNF121 ring finger protein 121 2 2
MIRT473436 MDM4 MDM4, p53 regulator 2 2
MIRT473636 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474242 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT474654 KLF13 Kruppel like factor 13 2 2
MIRT475384 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475400 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT476369 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT478017 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT478459 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478791 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT478952 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480412 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT481455 ARRB2 arrestin beta 2 2 2
MIRT481556 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT481740 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT483592 SLC26A9 solute carrier family 26 member 9 2 2
MIRT484423 SNX19 sorting nexin 19 2 2
MIRT484727 HOXB8 homeobox B8 2 6
MIRT487419 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487622 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT488048 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT488064 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT488587 ST7L suppression of tumorigenicity 7 like 2 2
MIRT488696 NAT9 N-acetyltransferase 9 (putative) 2 2
MIRT489175 ANKRD45 ankyrin repeat domain 45 2 4
MIRT490435 MYL9 myosin light chain 9 2 2
MIRT490452 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490704 FSTL4 follistatin like 4 2 2
MIRT491038 ALPK3 alpha kinase 3 2 2
MIRT491249 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491632 SEMA4G semaphorin 4G 2 2
MIRT492491 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492506 RANBP10 RAN binding protein 10 2 4
MIRT493917 FAM127B retrotransposon Gag like 8A 2 4
MIRT494012 DUSP9 dual specificity phosphatase 9 2 2
MIRT499188 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499813 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT501837 NCOA2 nuclear receptor coactivator 2 2 2
MIRT504067 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT505313 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT511829 H2AFX H2A histone family member X 2 4
MIRT515497 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT518629 NONO non-POU domain containing octamer binding 2 2
MIRT519774 ZNF354B zinc finger protein 354B 2 8
MIRT521806 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522621 MAP7D1 MAP7 domain containing 1 2 4
MIRT532803 CLDN11 claudin 11 2 2
MIRT533783 TMEM119 transmembrane protein 119 2 2
MIRT536433 KMT2B lysine methyltransferase 2B 2 6
MIRT538700 CASP16 caspase 16, pseudogene 2 4
MIRT544603 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT556730 KLHL15 kelch like family member 15 2 4
MIRT560587 LCE1B late cornified envelope 1B 2 2
MIRT560617 ANKRD36 ankyrin repeat domain 36 2 2
MIRT564348 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568925 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT570946 CPE carboxypeptidase E 2 2
MIRT571235 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT573805 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574149 MARVELD1 MARVEL domain containing 1 2 2
MIRT575772 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT576154 Hmox1 heme oxygenase 1 2 2
MIRT611312 CA8 carbonic anhydrase 8 2 4
MIRT615891 MT1A metallothionein 1A 2 2
MIRT669589 AK2 adenylate kinase 2 2 2
MIRT687186 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha 2 2
MIRT692711 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT701346 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT701997 MIER3 MIER family member 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-7 Berbamine derivative(BBMD3) NULL NULL Illumina HiSeq2000 brain 24732116 2014 down-regulated
miR-7 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-7 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-7 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-7 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-7 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-7 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-7 Interleukin 13 (IL-13) NULL NULL Quantitative real-time PCR bronchial epithelial cells 22453679 2012 down-regulated
miR-7 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-7 Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7515 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-7515 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-7515 Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-7515 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)

Error report submission