>ACSF2|NM_025149|3'UTR
   1 ATAAAGCAGCAGGCCTGTCCTGGCCGGTTGGCTTGACTCTCTCCTGTCAGAATGCAACCTGGCTTTATGCACCTAGATGT
  81 CCCCAGCACCCAGTTCTGAGCCAGGCACATCAAATGTCAAGGAATTGACTGAACGAACTAAGAGCTCCTGGATGGGTCCG
 161 GGAACTCGCCTGGGCACAAGGTGCCAAAAGGCAGGCAGCCTGCCCAGGCCCTCCCTCCTGTCCATCCCCCACATTCCCCT
 241 GTCTGTCCTTGTGATTTGGCATAAAGAGCTTCTGTTTTCTTTGGCTTCTTGCT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uacaGGGU--GGGGGUGAGGACa 5' |||| |||:| |||||| Target 5' cctgCCCAGGCCCTCCCTCCTGt 3'	199 - 221	139.00	-25.90
2	miRNA 3' uaCAGGG--UGGGGGUGAGGACa 5' ||||| :| |||| |:||| Target 5' atGTCCCCAGCACCCAGTTCTGa 3'	77 - 99	125.00	-24.30
3	miRNA 3' uacagggugggggUGAGGACa 5' :|||||| Target 5' gaacgaactaagaGCTCCTGg 3'	131 - 151	124.00	-12.00

Mutant ID	Mutant Position	Mutant Source
COSN30185901	11	COSMIC
COSN23015177	24	COSMIC
COSN24394953	27	COSMIC
COSN30489722	29	COSMIC
COSN30455354	31	COSMIC
COSN30157831	34	COSMIC
COSN30555268	43	COSMIC
COSN31492403	75	COSMIC
COSN26964899	81	COSMIC
COSN30544154	87	COSMIC
COSN30454488	92	COSMIC
COSN15800214	94	COSMIC
COSN9670195	108	COSMIC
COSN30179008	117	COSMIC
COSN31558458	136	COSMIC
COSN31572995	160	COSMIC
COSN7437514	188	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1431968873	1	dbSNP
rs201685284	3	dbSNP
rs141756545	11	dbSNP
rs1422634768	13	dbSNP
rs1187691701	17	dbSNP
rs757624113	17	dbSNP
rs368735162	26	dbSNP
rs370948216	27	dbSNP
rs758899221	28	dbSNP
rs780873840	29	dbSNP
rs375697411	31	dbSNP
rs1304647581	33	dbSNP
rs367961235	37	dbSNP
rs531889168	42	dbSNP
rs1204074509	47	dbSNP
rs879160735	48	dbSNP
rs745821078	51	dbSNP
rs1311767600	55	dbSNP
rs954317151	59	dbSNP
rs545021948	68	dbSNP
rs1051646854	71	dbSNP
rs1366100034	73	dbSNP
rs886335785	76	dbSNP
rs564716207	77	dbSNP
rs188063287	80	dbSNP
rs1368114235	82	dbSNP
rs940365886	86	dbSNP
rs547524403	89	dbSNP
rs1052585	97	dbSNP
rs1408964002	115	dbSNP
rs1303727818	116	dbSNP
rs1019845093	117	dbSNP
rs1436896909	119	dbSNP
rs1037297612	126	dbSNP
rs1389055275	130	dbSNP
rs760762368	132	dbSNP
rs572373099	135	dbSNP
rs1267166007	136	dbSNP
rs1356907969	146	dbSNP
rs1482192924	149	dbSNP
rs1254473426	150	dbSNP
rs1001270685	154	dbSNP
rs748535860	160	dbSNP
rs182026193	161	dbSNP
rs1466292515	162	dbSNP
rs1296922343	168	dbSNP
rs990482040	172	dbSNP
rs1385526954	178	dbSNP
rs1189519750	182	dbSNP
rs1009246999	189	dbSNP
rs549690571	191	dbSNP
rs949020317	202	dbSNP
rs1020550398	205	dbSNP
rs1400576275	215	dbSNP
rs1427115668	224	dbSNP
rs555443517	225	dbSNP
rs1369580778	226	dbSNP
rs538550364	235	dbSNP
rs1163371541	239	dbSNP
rs551801289	240	dbSNP
rs1054014187	241	dbSNP
rs7627	242	dbSNP
rs545643481	254	dbSNP
rs1252462072	283	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.