pre-miRNA Information
pre-miRNA hsa-mir-3689d-1   
Genomic Coordinates chr9: 134849609 - 134849682
Description Homo sapiens miR-3689d-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3689d-2   
Genomic Coordinates chr9: 134850277 - 134850356
Description Homo sapiens miR-3689d-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3689d
Sequence 2| GGGAGGUGUGAUCUCACACUCG |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs551722268 8 dbSNP
rs143142996 8 dbSNP
rs1236297052 12 dbSNP
rs573148947 14 dbSNP
rs1210004979 14 dbSNP
rs1217460444 14 dbSNP
rs762590109 18 dbSNP
rs574332265 18 dbSNP
rs1164353021 21 dbSNP
rs963741171 21 dbSNP
rs1177416877 22 dbSNP
rs765777344 22 dbSNP
Putative Targets

Gene Information
Gene Symbol CD207   
Synonyms CLEC4K
Description CD207 molecule
Transcript NM_015717   
Expression
Putative miRNA Targets on CD207
3'UTR of CD207
(miRNA target sites are highlighted)
>CD207|NM_015717|3'UTR
   1 CAGGACAGGCTCCCAAGCTCACTCTTTGAGCTCCAACGCTTGTTAAACATGAGGAAATGCCTCTTTCTTCCCCAGACTCC
  81 AGGATGACTTTGCACGTTAATTTTTCTTGCTTCAAAATTGTCCCACAGTGGCATTCTGGAGTCCGTCTGTCTTGGCTGGA
 161 AATTCTCTGACGTCTTGGAGGCAGCTGGAATGGAAAGGAGAATTCAGGTTAAAGTGGGAGGGGTGGGTAGAGAGGATTTA
 241 GAAGTTCCAATTGCCCTGCTAAGGAGGATCAAGACCCGTAATCCGGCATAACACCCTGGGGTTTTCCACTCTTTCAGAGA
 321 AACCTCAGCTTCATCACATCAAAGTTACTCCAGAGCAACCAAGCAATTCTCCTGATATTGTCATCCAGGGCTTTTCTTGG
 401 CCAAACCCCCTAGAATTTCCATGTCTCTGCTTAGCTGTGCTGGCAGCTAGCAGCTGGCTGTGTTTGCAGTGCAAATAGCT
 481 CTGTTCTTGGAAATCCTGCTCATGGTATGTCCCCAGTGGTTTCTTCATCCACATCATCTAAAGCCTGAACCCGTTCTTCT
 561 CTGGTTCAAGTCAGTGGCTGACACGGACTTGTATCTCCTTCAGAGCTCGGCTGGCACCCAGCCTCCCTTCTCCTTCCACT
 641 CCCTTAGTACACTGGAGTGCCGAGCCCTGCCTTCCACCCAGCGTCCATCCAGCCCCTGTCCTCACCTCTCCGGCACCTCC
 721 TCCTCCTTCTGCATTTCCTATCTTCCTGTGTCTTGTGCATGGGAAGCAGCCTTCAGTGCCTTCATGAATTCACCTTCCAG
 801 CTTCCTCAGAATAAAATGCTGCCTGGGTCAAGGACTCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gcucacacucuagUGUGGAGGg 5'
                       :||||||| 
Target 5' cctcacctctccgGCACCTCCt 3'
700 - 721 141.00 -13.20
2
miRNA  3' gcUCAC---ACU-CUAGUGUGGAGGg 5'
            ||||   | | || : |||||:| 
Target 5' tcAGTGCCTTCATGAATTCACCTTCc 3'
773 - 798 136.00 -15.00
3
miRNA  3' gcUCAC--ACU----CU-AGUGUGGAGGg 5'
            ||||  |||    || |:::|:|||| 
Target 5' tcAGTGGCTGACACGGACTTGTATCTCCt 3'
571 - 599 128.00 -13.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31588548 3 COSMIC
COSN30515397 10 COSMIC
COSN30489174 12 COSMIC
COSN31576967 14 COSMIC
COSN28189276 17 COSMIC
COSN30157074 28 COSMIC
COSN14005227 38 COSMIC
COSN30462493 42 COSMIC
COSN30499808 43 COSMIC
COSN31505451 44 COSMIC
COSN30120692 54 COSMIC
COSN31522104 62 COSMIC
COSN30489213 70 COSMIC
COSN15906567 71 COSMIC
COSN30517808 73 COSMIC
COSN31581393 86 COSMIC
COSN29429545 89 COSMIC
COSN31572399 95 COSMIC
COSN31526630 144 COSMIC
COSN27176412 162 COSMIC
COSN31571522 193 COSMIC
COSN29509260 737 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs370635955 6 dbSNP
rs533708008 15 dbSNP
rs1438593027 21 dbSNP
rs781875236 22 dbSNP
rs782700461 26 dbSNP
rs782643159 27 dbSNP
rs17006424 30 dbSNP
rs1056911887 31 dbSNP
rs782445651 35 dbSNP
rs1218222195 36 dbSNP
rs144452787 37 dbSNP
rs140660157 38 dbSNP
rs782162189 39 dbSNP
rs376522449 49 dbSNP
rs1452682893 53 dbSNP
rs946907468 54 dbSNP
rs1239833085 59 dbSNP
rs1474825109 60 dbSNP
rs1193788794 61 dbSNP
rs1425239471 68 dbSNP
rs568266745 71 dbSNP
rs1474026923 72 dbSNP
rs1163924799 74 dbSNP
rs1414343184 76 dbSNP
rs1406986155 85 dbSNP
rs1316191633 87 dbSNP
rs1344557367 88 dbSNP
rs1399436935 92 dbSNP
rs116070623 95 dbSNP
rs76441599 96 dbSNP
rs934327828 109 dbSNP
rs1283972226 128 dbSNP
rs1357548125 139 dbSNP
rs1230507910 142 dbSNP
rs562823755 143 dbSNP
rs190774979 145 dbSNP
rs371710720 148 dbSNP
rs1264771531 151 dbSNP
rs1484480925 170 dbSNP
rs74392937 171 dbSNP
rs545749043 172 dbSNP
rs1473627381 173 dbSNP
rs1156624912 180 dbSNP
rs1407077670 192 dbSNP
rs921074641 198 dbSNP
rs1420246271 205 dbSNP
rs1159316521 207 dbSNP
rs540751386 208 dbSNP
rs1413136498 215 dbSNP
rs186059238 218 dbSNP
rs962569793 223 dbSNP
rs1341324351 225 dbSNP
rs1016858599 227 dbSNP
rs183556916 232 dbSNP
rs951325569 235 dbSNP
rs1241584290 253 dbSNP
rs1287499418 254 dbSNP
rs1035039508 255 dbSNP
rs1345179880 261 dbSNP
rs1004011327 264 dbSNP
rs1199408366 267 dbSNP
rs1256372733 270 dbSNP
rs782715836 277 dbSNP
rs769058777 278 dbSNP
rs1179329023 279 dbSNP
rs544529240 283 dbSNP
rs1440234295 284 dbSNP
rs142322494 285 dbSNP
rs148723258 287 dbSNP
rs2110980 289 dbSNP
rs386647176 290 dbSNP
rs144214899 298 dbSNP
rs1416435211 299 dbSNP
rs782779696 301 dbSNP
rs1376674859 311 dbSNP
rs1448141948 316 dbSNP
rs924244198 323 dbSNP
rs1369467014 338 dbSNP
rs1231801267 344 dbSNP
rs1050801757 346 dbSNP
rs782132003 350 dbSNP
rs3732245 352 dbSNP
rs1346669852 359 dbSNP
rs921009755 380 dbSNP
rs975198834 386 dbSNP
rs533902922 388 dbSNP
rs1257161554 390 dbSNP
rs568121999 399 dbSNP
rs782023297 400 dbSNP
rs909723379 401 dbSNP
rs982666690 406 dbSNP
rs1378342968 418 dbSNP
rs548367482 422 dbSNP
rs782818242 423 dbSNP
rs1168862040 451 dbSNP
rs1035371554 453 dbSNP
rs1333794908 460 dbSNP
rs982119542 472 dbSNP
rs1386764979 483 dbSNP
rs1301359150 496 dbSNP
rs140562210 512 dbSNP
rs1224768193 516 dbSNP
rs1277129839 517 dbSNP
rs1318196089 535 dbSNP
rs1200227884 544 dbSNP
rs1488111993 550 dbSNP
rs17656758 552 dbSNP
rs1268115339 553 dbSNP
rs1010950752 561 dbSNP
rs893943355 564 dbSNP
rs1453350528 567 dbSNP
rs1031144305 569 dbSNP
rs1423099987 577 dbSNP
rs1478278468 584 dbSNP
rs1173256391 585 dbSNP
rs191974180 595 dbSNP
rs1457816988 604 dbSNP
rs1294684361 606 dbSNP
rs772022119 608 dbSNP
rs552535044 609 dbSNP
rs1297050393 610 dbSNP
rs1052475188 613 dbSNP
rs1220156010 615 dbSNP
rs1291175460 617 dbSNP
rs532530758 619 dbSNP
rs1320942069 622 dbSNP
rs1245272445 638 dbSNP
rs1267099161 644 dbSNP
rs1348460653 648 dbSNP
rs1214470007 655 dbSNP
rs1262642723 661 dbSNP
rs560496919 662 dbSNP
rs1196172837 665 dbSNP
rs933668801 667 dbSNP
rs1254485391 682 dbSNP
rs1423553617 683 dbSNP
rs1165968685 686 dbSNP
rs1370641813 693 dbSNP
rs1418427663 697 dbSNP
rs546746764 704 dbSNP
rs530224381 711 dbSNP
rs782339783 712 dbSNP
rs1039437149 717 dbSNP
rs187218297 720 dbSNP
rs1396325046 724 dbSNP
rs1314629282 725 dbSNP
rs1315042764 728 dbSNP
rs745911300 731 dbSNP
rs1285360883 732 dbSNP
rs1354567102 742 dbSNP
rs544779826 749 dbSNP
rs1254445891 759 dbSNP
rs531041582 763 dbSNP
rs1182750358 777 dbSNP
rs982593007 781 dbSNP
rs1438345671 783 dbSNP
rs1178617149 786 dbSNP
rs1381495650 792 dbSNP
rs1420940860 807 dbSNP
rs1173348099 818 dbSNP
rs1358156788 827 dbSNP
rs1466283199 834 dbSNP
rs929825454 838 dbSNP
rs1304364440 839 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 50489.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000410009.3 | 3UTR | UCUCCGGCACCUCCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000410009.3 | 3UTR | UCUCCGGCACCUCCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000410009.3 | 3UTR | UCUCCGGCACCUCCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000410009.3 | 3UTR | CUCUCCGGCACCUCCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000410009.3 | 3UTR | CUCUCCGGCACCUCCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000410009.3 | 3UTR | UCACCUCUCCGGCACCUCCUCCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
231 hsa-miR-3689d Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059166 TXNIP thioredoxin interacting protein 2 4
MIRT080699 KIAA1468 KIAA1468 2 2
MIRT218770 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT278059 KHNYN KH and NYN domain containing 2 2
MIRT345933 EIF4A1 eukaryotic translation initiation factor 4A1 2 2
MIRT366238 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT449689 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT451149 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451266 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT451375 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451570 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451585 HIRIP3 HIRA interacting protein 3 2 2
MIRT451614 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451763 ZNF611 zinc finger protein 611 2 6
MIRT452383 LY6E lymphocyte antigen 6 family member E 2 4
MIRT452573 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452735 PTGES3L prostaglandin E synthase 3 like 2 6
MIRT452867 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT452975 CABP4 calcium binding protein 4 2 2
MIRT453215 CERS1 ceramide synthase 1 2 2
MIRT453259 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT453449 GLG1 golgi glycoprotein 1 2 2
MIRT453479 PITPNM3 PITPNM family member 3 2 2
MIRT453663 CD207 CD207 molecule 2 6
MIRT453724 RAP1GDS1 Rap1 GTPase-GDP dissociation stimulator 1 2 2
MIRT453760 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT454181 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454330 PPARA peroxisome proliferator activated receptor alpha 2 2
MIRT454338 CDKL1 cyclin dependent kinase like 1 2 2
MIRT454427 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454665 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT454825 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT455130 TBC1D25 TBC1 domain family member 25 2 2
MIRT455166 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455416 RXRB retinoid X receptor beta 2 2
MIRT455668 GLO1 glyoxalase I 2 2
MIRT455999 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456446 TMEM81 transmembrane protein 81 2 2
MIRT456642 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT456728 TMEM239 transmembrane protein 239 2 2
MIRT457131 ASPH aspartate beta-hydroxylase 2 2
MIRT457157 MXRA7 matrix remodeling associated 7 2 2
MIRT457358 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457458 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT457619 UPK3BL uroplakin 3B like 1 2 2
MIRT457692 ZNF587 zinc finger protein 587 2 2
MIRT457727 SMOX spermine oxidase 2 2
MIRT457788 VWA1 von Willebrand factor A domain containing 1 2 2
MIRT457875 THEM6 thioesterase superfamily member 6 2 4
MIRT457909 ZNF212 zinc finger protein 212 2 2
MIRT458395 ABCF1 ATP binding cassette subfamily F member 1 2 2
MIRT458496 MARVELD2 MARVEL domain containing 2 2 2
MIRT458544 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT458577 TCOF1 treacle ribosome biogenesis factor 1 2 2
MIRT458732 CES2 carboxylesterase 2 2 2
MIRT458814 ZNF843 zinc finger protein 843 2 2
MIRT458931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT459341 ZNF17 zinc finger protein 17 2 2
MIRT459365 MPLKIP M-phase specific PLK1 interacting protein 2 6
MIRT459572 NLGN2 neuroligin 2 2 2
MIRT460015 DTX3L deltex E3 ubiquitin ligase 3L 2 4
MIRT460144 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460653 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460798 VPS33A VPS33A, CORVET/HOPS core subunit 2 2
MIRT461058 KCNK6 potassium two pore domain channel subfamily K member 6 2 4
MIRT461458 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461572 SCO1 SCO1, cytochrome c oxidase assembly protein 2 4
MIRT461927 TNFSF14 TNF superfamily member 14 2 2
MIRT461953 C3 complement C3 2 2
MIRT462278 KRR1 KRR1, small subunit processome component homolog 2 2
MIRT462744 EFNB1 ephrin B1 2 2
MIRT463136 ZNF451 zinc finger protein 451 2 4
MIRT463566 ZBTB39 zinc finger and BTB domain containing 39 2 6
MIRT463866 WNT7B Wnt family member 7B 2 2
MIRT464326 UST uronyl 2-sulfotransferase 2 2
MIRT464796 UBE2F ubiquitin conjugating enzyme E2 F (putative) 2 2
MIRT465034 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT466207 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT467007 SSBP2 single stranded DNA binding protein 2 2 2
MIRT467029 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT468001 SKI SKI proto-oncogene 2 2
MIRT468031 SIKE1 suppressor of IKBKE 1 2 6
MIRT468575 SERBP1 SERPINE1 mRNA binding protein 1 2 6
MIRT468834 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT468970 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469450 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470888 PLXND1 plexin D1 2 2
MIRT470953 PKM pyruvate kinase, muscle 2 2
MIRT471828 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT472590 NACC1 nucleus accumbens associated 1 2 2
MIRT472805 MTMR12 myotubularin related protein 12 2 2
MIRT472818 MTMR10 myotubularin related protein 10 2 6
MIRT472914 MSN moesin 2 2
MIRT474558 KLHDC3 kelch domain containing 3 2 2
MIRT474716 KIF13A kinesin family member 13A 2 6
MIRT475279 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475300 IFNLR1 interferon lambda receptor 1 2 2
MIRT475759 HDLBP high density lipoprotein binding protein 2 2
MIRT475786 HDGF heparin binding growth factor 2 2
MIRT475933 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476212 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT476238 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 4
MIRT476799 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT477988 DNAL1 dynein axonemal light chain 1 2 2
MIRT478317 DDN dendrin 2 2
MIRT479257 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT479344 CEP97 centrosomal protein 97 2 2
MIRT479522 CDCA4 cell division cycle associated 4 2 2
MIRT479906 CCDC117 coiled-coil domain containing 117 2 6
MIRT481147 AVL9 AVL9 cell migration associated 2 6
MIRT481735 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482089 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT482389 AEN apoptosis enhancing nuclease 2 2
MIRT483093 TFPI tissue factor pathway inhibitor 2 2
MIRT484246 ANK1 ankyrin 1 2 2
MIRT484342 EPN1 epsin 1 2 4
MIRT489141 C5orf38 chromosome 5 open reading frame 38 2 2
MIRT489163 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489547 SOX11 SRY-box 11 2 4
MIRT489780 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489799 KRT80 keratin 80 2 6
MIRT490535 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT492198 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492283 SHISA6 shisa family member 6 2 4
MIRT501059 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT501094 SLC5A6 solute carrier family 5 member 6 2 4
MIRT503870 CBS cystathionine-beta-synthase 2 2
MIRT507981 BCL2L13 BCL2 like 13 2 4
MIRT508125 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT508205 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508385 SPTBN2 spectrin beta, non-erythrocytic 2 2 4
MIRT510308 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT510462 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT512227 ATXN3 ataxin 3 2 8
MIRT512665 STEAP3 STEAP3 metalloreductase 2 2
MIRT514184 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT515053 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515138 ZNF799 zinc finger protein 799 2 4
MIRT515452 ZNF747 zinc finger protein 747 2 2
MIRT515791 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT515905 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT516129 MRPS16 mitochondrial ribosomal protein S16 2 6
MIRT516679 ZNF860 zinc finger protein 860 2 4
MIRT516750 ZNF100 zinc finger protein 100 2 2
MIRT516971 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT517491 NPAP1 nuclear pore associated protein 1 2 2
MIRT517774 PROM2 prominin 2 2 2
MIRT517938 ZNF431 zinc finger protein 431 2 4
MIRT518386 ZNF250 zinc finger protein 250 2 2
MIRT520621 TMEM41B transmembrane protein 41B 2 2
MIRT521028 SLC30A5 solute carrier family 30 member 5 2 2
MIRT521454 RAD51 RAD51 recombinase 2 2
MIRT521564 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT521581 PTBP2 polypyrimidine tract binding protein 2 2 2
MIRT522263 NKRF NFKB repressing factor 2 2
MIRT522410 MXI1 MAX interactor 1, dimerization protein 2 2
MIRT522543 MED28 mediator complex subunit 28 2 6
MIRT522915 KCNE3 potassium voltage-gated channel subfamily E regulatory subunit 3 2 2
MIRT523029 IGF1 insulin like growth factor 1 2 2
MIRT523854 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT524184 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT524520 CDK19 cyclin dependent kinase 19 2 2
MIRT524674 C12orf5 TP53 induced glycolysis regulatory phosphatase 2 2
MIRT530257 ZNF620 zinc finger protein 620 2 2
MIRT540691 BMP3 bone morphogenetic protein 3 2 2
MIRT540976 C17orf85 nuclear cap binding subunit 3 2 2
MIRT545505 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT545631 GGCX gamma-glutamyl carboxylase 2 2
MIRT547358 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT550701 MPL MPL proto-oncogene, thrombopoietin receptor 2 4
MIRT550717 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT551203 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT553999 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 4
MIRT561081 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT563523 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT564463 SLC35E2 solute carrier family 35 member E2 2 2
MIRT565233 TRAF6 TNF receptor associated factor 6 2 2
MIRT566618 NKAP NFKB activating protein 2 2
MIRT569527 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT569639 QPCT glutaminyl-peptide cyclotransferase 2 2
MIRT570253 SSPN sarcospan 2 2
MIRT570570 OTUD7B OTU deubiquitinase 7B 2 2
MIRT570621 MTF2 metal response element binding transcription factor 2 2 2
MIRT571098 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 2 2
MIRT575196 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575554 Cd99 CD99 antigen 2 2
MIRT575634 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 2
MIRT608267 NOP14 NOP14 nucleolar protein 2 2
MIRT609314 FXYD6 FXYD domain containing ion transport regulator 6 2 2
MIRT627670 RPL28 ribosomal protein L28 2 2
MIRT631185 TSPAN14 tetraspanin 14 2 2
MIRT631964 YIPF5 Yip1 domain family member 5 2 2
MIRT632885 GINM1 glycoprotein integral membrane 1 2 2
MIRT642618 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT645609 TSPAN6 tetraspanin 6 2 2
MIRT662227 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662329 MYLK3 myosin light chain kinase 3 2 2
MIRT662725 LRRC3C leucine rich repeat containing 3C 2 2
MIRT665520 USP14 ubiquitin specific peptidase 14 2 2
MIRT666634 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT668969 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT670925 DESI1 desumoylating isopeptidase 1 2 2
MIRT673939 ZNF500 zinc finger protein 500 2 2
MIRT674675 PLCE1 phospholipase C epsilon 1 2 2
MIRT675230 MAK male germ cell associated kinase 2 2
MIRT680864 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT681047 ZDBF2 zinc finger DBF-type containing 2 2 2
MIRT681105 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT683553 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT684508 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT684812 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT685981 CCDC77 coiled-coil domain containing 77 2 2
MIRT686709 TBC1D19 TBC1 domain family member 19 2 2
MIRT686867 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688908 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT691208 KLHL30 kelch like family member 30 2 2
MIRT692298 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT694380 MTA1 metastasis associated 1 2 2
MIRT696497 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT700686 POLR3D RNA polymerase III subunit D 2 2
MIRT701088 PAPOLG poly(A) polymerase gamma 2 2
MIRT703373 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT706189 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT706648 SMIM19 small integral membrane protein 19 2 2
MIRT709466 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT709699 DMWD DM1 locus, WD repeat containing 2 2
MIRT710693 LYRM4 LYR motif containing 4 2 2
MIRT713457 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 2 2
MIRT722409 RARS2 arginyl-tRNA synthetase 2, mitochondrial 2 2
MIRT725391 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT725548 DNMT3A DNA methyltransferase 3 alpha 2 2

Error report submission