>CEBPD|NM_005195|3'UTR
   1 CGCGCGGCCGGGGCGGGAGAGACTCAGCAACGACCCATACCTCAGACCCGACGGCCCGGAGCGGAGCGCGCCCTGCCCTG
  81 GCGCAGCCAGAGCCGCCGGGTGCCCGCTGCAGTTTCTTGGGACATAGGAGCGCAAAGAAGCTACAGCCTGGACTTACCAC
 161 CACTAAACTGCGAGAGAAGCTAAACGTGTTTATTTTCCCTTAAATTATTTTTGTAATGGTAGCTTTTTCTACATCTTACT
 241 CCTGTTGATGCAGCTAAGGTACATTTGTAAAAAGAAAAAAAACCAGACTTTTCAGACAAACCCTTTGTATTGTAGATAAG
 321 AGGAAAAGACTGAGCATGCTCACTTTTTTATATTAATTTTTACAGTATTTGTAAGAATAAAGCAGCATTTGAAATCGAAA
 401 AAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uaaAUCGGUUAACAGGUAGAAa 5' ||||: || | |||||| Target 5' tggTAGCTTTTTCTACATCTTa 3'	217 - 238	135.00	-9.20
2	miRNA 3' uaaaUCGGUU--AACAGGUAGAAa 5' |||:|| |||::||:|| Target 5' gagaAGCTAAACGTGTTTATTTTc 3'	174 - 197	120.00	-11.20
3	miRNA 3' uaaaUCGGUUAACAGGUAGAaa 5' |||:|| || |||:| Target 5' atgcAGCTAA-GGTACATTTgt 3'	248 - 268	97.00	-6.60

Mutant ID	Mutant Position	Mutant Source
COSN30487391	10	COSMIC
COSN30454740	11	COSMIC
COSN26970250	13	COSMIC
COSN30500005	16	COSMIC
COSN31505056	25	COSMIC
COSN26970249	77	COSMIC
COSN8087328	116	COSMIC
COSN1365307	274	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1254160530	2	dbSNP
rs376742290	3	dbSNP
rs992000362	4	dbSNP
rs746367193	6	dbSNP
rs774621813	10	dbSNP
rs771311121	19	dbSNP
rs1420145553	21	dbSNP
rs1396253807	23	dbSNP
rs779185031	23	dbSNP
rs749555584	28	dbSNP
rs777973310	29	dbSNP
rs1422715952	30	dbSNP
rs769960354	31	dbSNP
rs748249994	32	dbSNP
rs1398029953	34	dbSNP
rs781225664	38	dbSNP
rs758306640	41	dbSNP
rs1453325532	42	dbSNP
rs1248313631	46	dbSNP
rs1195312808	47	dbSNP
rs374190201	49	dbSNP
rs576166478	50	dbSNP
rs1022040570	57	dbSNP
rs985984856	58	dbSNP
rs1347142341	59	dbSNP
rs1230956761	65	dbSNP
rs1183800136	68	dbSNP
rs931920241	72	dbSNP
rs925586166	77	dbSNP
rs1196414356	81	dbSNP
rs1006573377	82	dbSNP
rs1345814105	83	dbSNP
rs1195968958	84	dbSNP
rs978388800	85	dbSNP
rs1254008613	90	dbSNP
rs1454066895	95	dbSNP
rs1174585414	97	dbSNP
rs1462075044	98	dbSNP
rs764603613	98	dbSNP
rs1397719865	99	dbSNP
rs967054447	102	dbSNP
rs1326395829	105	dbSNP
rs1369992117	107	dbSNP
rs912953085	111	dbSNP
rs1277088563	112	dbSNP
rs992619652	115	dbSNP
rs1297676630	124	dbSNP
rs961130780	126	dbSNP
rs1307955033	131	dbSNP
rs1228296689	132	dbSNP
rs1035212699	134	dbSNP
rs557787911	138	dbSNP
rs1316355057	140	dbSNP
rs1273970889	141	dbSNP
rs1002417459	146	dbSNP
rs889430269	149	dbSNP
rs1264545388	155	dbSNP
rs1429601689	157	dbSNP
rs539250888	163	dbSNP
rs565837615	164	dbSNP
rs1420820516	165	dbSNP
rs1462508778	179	dbSNP
rs1165203308	189	dbSNP
rs1268747985	193	dbSNP
rs1393227414	194	dbSNP
rs370373992	195	dbSNP
rs1027943387	202	dbSNP
rs1450821060	204	dbSNP
rs994838054	207	dbSNP
rs897851239	217	dbSNP
rs1036844308	228	dbSNP
rs1276160271	231	dbSNP
rs1338521604	235	dbSNP
rs11539253	239	dbSNP
rs568242672	241	dbSNP
rs1274060628	242	dbSNP
rs549795482	248	dbSNP
rs187895598	251	dbSNP
rs537591543	256	dbSNP
rs925868099	258	dbSNP
rs755824546	262	dbSNP
rs1042976538	274	dbSNP
rs1417138337	277	dbSNP
rs564181221	282	dbSNP
rs945689840	283	dbSNP
rs948727119	283	dbSNP
rs992781041	283	dbSNP
rs912909027	284	dbSNP
rs752101017	290	dbSNP
rs552256601	293	dbSNP
rs749399932	299	dbSNP
rs1377141321	301	dbSNP
rs959819560	306	dbSNP
rs928083956	309	dbSNP
rs980922286	316	dbSNP
rs1226811028	317	dbSNP
rs1309352477	318	dbSNP
rs1234624283	319	dbSNP
rs969567932	320	dbSNP
rs1307068166	325	dbSNP
rs1022071683	326	dbSNP
rs1284534186	328	dbSNP
rs1486928216	328	dbSNP
rs1211062048	342	dbSNP
rs1230443421	343	dbSNP
rs1236370470	345	dbSNP
rs1178577658	350	dbSNP
rs1335902388	350	dbSNP
rs1408209565	352	dbSNP
rs533589870	358	dbSNP
rs1438874875	365	dbSNP
rs1293254053	366	dbSNP
rs1156586014	382	dbSNP
rs1396851627	383	dbSNP
rs1435261730	386	dbSNP
rs1313627680	394	dbSNP
rs1413448292	395	dbSNP
rs113665053	399	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.