pre-miRNA Information
pre-miRNA hsa-mir-4651   
Genomic Coordinates chr7: 75915197 - 75915269
Description Homo sapiens miR-4651 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4651
Sequence 10| CGGGGUGGGUGAGGUCGGGC |29
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30595227 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1458858872 1 dbSNP
rs887877274 2 dbSNP
rs559953168 4 dbSNP
rs1332072774 12 dbSNP
rs868980356 12 dbSNP
rs1291879524 14 dbSNP
rs1228835859 19 dbSNP
rs1349605668 19 dbSNP
rs1277626081 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SAA1   
Synonyms PIG4, SAA, SAA2, TP53I4
Description serum amyloid A1
Transcript NM_000331   
Other Transcripts NM_001178006 , NM_199161   
Expression
Putative miRNA Targets on SAA1
3'UTR of SAA1
(miRNA target sites are highlighted)
>SAA1|NM_000331|3'UTR
   1 GCTTCCTCTTCACTCTGCTCTCAGGAGATCTGGCTGTGAGGCCCTCAGGGCAGGGATACAAAGCGGGGAGAGGGTACACA
  81 ATGGGTATCTAATAAATACTTAAGAGGTGGAATTTGTGGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cgggcuGGAGUGGGUGGGGc 5'
                |||| ::|||:|: 
Target 5' --gcttCCTC-TTCACTCTg 3'
1 - 17 105.00 -17.10
2
miRNA  3' cgggcuggagugggUGGGGc 5'
                        :|||: 
Target 5' gatctggctgtgagGCCCTc 3'
27 - 46 68.00 -12.84
3
miRNA  3' cgggcuggaguggGUGgggc 5'
                       |||    
Target 5' cggggagagggtaCACaatg 3'
64 - 83 60.00 -5.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30692823 16 COSMIC
COSN31576881 34 COSMIC
COSN30520892 39 COSMIC
COSN30190365 42 COSMIC
COSN31493533 56 COSMIC
COSN30178493 65 COSMIC
COSN30502376 65 COSMIC
COSN18736230 66 COSMIC
COSN31509741 67 COSMIC
COSN30453179 68 COSMIC
COSN30490580 69 COSMIC
COSN31560933 71 COSMIC
COSN30493065 85 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1219431280 3 dbSNP
rs1271747446 9 dbSNP
rs1288448926 12 dbSNP
rs1342574994 18 dbSNP
rs1218627794 23 dbSNP
rs547627072 24 dbSNP
rs1349879594 26 dbSNP
rs183981346 31 dbSNP
rs1375428406 33 dbSNP
rs1261775321 37 dbSNP
rs1488430432 39 dbSNP
rs1445734981 41 dbSNP
rs1194834394 46 dbSNP
rs780300491 48 dbSNP
rs11821600 52 dbSNP
rs552063508 58 dbSNP
rs1452432784 65 dbSNP
rs1043319594 66 dbSNP
rs939501263 68 dbSNP
rs934797003 73 dbSNP
rs1164153813 74 dbSNP
rs1401844799 75 dbSNP
rs1053318357 77 dbSNP
rs569920581 79 dbSNP
rs1057121369 80 dbSNP
rs1157297569 82 dbSNP
rs1439491333 83 dbSNP
rs1253963644 85 dbSNP
rs895398739 86 dbSNP
rs895859549 88 dbSNP
rs1195121082 91 dbSNP
rs1466857447 92 dbSNP
rs1381662801 97 dbSNP
rs146642944 105 dbSNP
rs1229041336 107 dbSNP
rs1044026039 111 dbSNP
rs1014345287 113 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cgGGCUGGAGUGGGUGGGGc 5'
            |||  |||||||||||| 
Target 5' -aCCG--CUCACCCACCCCc 3'
1 - 17
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000405158.2 | 3UTR | ACCGCUCACCCACCCCCUCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
121 hsa-miR-4651 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066212 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT113270 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 2
MIRT115795 CAPN15 calpain 15 2 2
MIRT125296 MID1IP1 MID1 interacting protein 1 2 2
MIRT145419 ANKRD13B ankyrin repeat domain 13B 2 2
MIRT153779 NCOA3 nuclear receptor coactivator 3 2 2
MIRT189384 TXLNA taxilin alpha 2 4
MIRT451063 PNMAL2 paraneoplastic Ma antigen family member 8B 2 2
MIRT451142 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT452374 LY6E lymphocyte antigen 6 family member E 2 4
MIRT452788 FAM136A family with sequence similarity 136 member A 2 2
MIRT452985 CABP4 calcium binding protein 4 2 2
MIRT453231 FTSJ3 FtsJ RNA methyltransferase homolog 3 2 2
MIRT453824 SAA1 serum amyloid A1 2 2
MIRT454136 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT455104 NKX2-2 NK2 homeobox 2 2 6
MIRT455250 DDX39B DExD-box helicase 39B 2 10
MIRT456899 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457099 DCX doublecortin 2 2
MIRT457761 ZC3H12B zinc finger CCCH-type containing 12B 2 4
MIRT458539 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT459011 UQCRH ubiquinol-cytochrome c reductase hinge protein 2 2
MIRT459197 RCE1 Ras converting CAAX endopeptidase 1 2 2
MIRT459295 PHYKPL 5-phosphohydroxy-L-lysine phospho-lyase 2 2
MIRT459466 MUC17 mucin 17, cell surface associated 2 4
MIRT459598 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT461274 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT464551 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT465253 TRIM44 tripartite motif containing 44 2 2
MIRT465274 TRIM28 tripartite motif containing 28 2 2
MIRT465402 TP53 tumor protein p53 2 2
MIRT465877 TMEM43 transmembrane protein 43 2 4
MIRT466234 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT467027 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT468320 SF3B3 splicing factor 3b subunit 3 2 2
MIRT468437 SETD1B SET domain containing 1B 2 2
MIRT468691 SEC22C SEC22 homolog C, vesicle trafficking protein 2 4
MIRT468863 RREB1 ras responsive element binding protein 1 2 2
MIRT469779 RAB15 RAB15, member RAS oncogene family 2 2
MIRT470314 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT470765 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT472213 NGFR nerve growth factor receptor 2 2
MIRT472520 NACC1 nucleus accumbens associated 1 2 2
MIRT473281 MFRP membrane frizzled-related protein 2 2
MIRT473403 MDM4 MDM4, p53 regulator 2 2
MIRT473521 MAX MYC associated factor X 2 2
MIRT474529 KLHDC8A kelch domain containing 8A 2 2
MIRT474631 KLF16 Kruppel like factor 16 2 2
MIRT475130 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475808 HDGF heparin binding growth factor 2 2
MIRT478623 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT479501 CDH6 cadherin 6 2 2
MIRT479865 CCDC6 coiled-coil domain containing 6 2 2
MIRT480132 CALR calreticulin 2 2
MIRT480529 C10orf76 chromosome 10 open reading frame 76 2 2
MIRT480774 BMP2 bone morphogenetic protein 2 2 2
MIRT481423 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT481778 APEX1 apurinic/apyrimidinic endodeoxyribonuclease 1 2 2
MIRT481821 AP2M1 adaptor related protein complex 2 mu 1 subunit 2 2
MIRT482698 XRCC3 X-ray repair cross complementing 3 2 2
MIRT482976 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT483391 SPATA6 spermatogenesis associated 6 2 4
MIRT483429 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483476 STMN3 stathmin 3 2 4
MIRT483687 CYP11A1 cytochrome P450 family 11 subfamily A member 1 2 2
MIRT483803 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 6
MIRT484335 EPN1 epsin 1 2 4
MIRT484683 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT484966 UCK1 uridine-cytidine kinase 1 2 2
MIRT485987 YIPF2 Yip1 domain family member 2 2 2
MIRT486773 SESTD1 SEC14 and spectrin domain containing 1 2 4
MIRT487372 C10orf54 V-set immunoregulatory receptor 2 2
MIRT487632 ONECUT3 one cut homeobox 3 2 4
MIRT488080 DLGAP3 DLG associated protein 3 2 4
MIRT488158 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488463 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT490948 PPM1F protein phosphatase, Mg2+/Mn2+ dependent 1F 2 2
MIRT491719 RTN4R reticulon 4 receptor 2 2
MIRT492338 SEPT8 septin 8 2 2
MIRT493038 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT493368 KIAA1614 KIAA1614 2 2
MIRT499384 PLCG2 phospholipase C gamma 2 2 11
MIRT499596 ANKRD45 ankyrin repeat domain 45 2 2
MIRT499730 USH1G USH1 protein network component sans 2 4
MIRT500357 ZNF385A zinc finger protein 385A 2 2
MIRT501691 PCGF3 polycomb group ring finger 3 2 6
MIRT504502 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT509579 HIST2H2AB histone cluster 2 H2A family member b 2 4
MIRT510610 TPM3 tropomyosin 3 2 2
MIRT512803 GLRX glutaredoxin 2 2
MIRT513302 SETBP1 SET binding protein 1 2 2
MIRT514005 CECR2 CECR2, histone acetyl-lysine reader 2 4
MIRT515701 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT518260 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT523183 HIST3H3 histone cluster 3 H3 2 2
MIRT524051 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT538642 CCSAP centriole, cilia and spindle associated protein 2 2
MIRT541497 ADM adrenomedullin 2 2
MIRT569279 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT570279 ARPC3 actin related protein 2/3 complex subunit 3 2 2
MIRT570326 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT571451 YKT6 YKT6 v-SNARE homolog 2 2
MIRT571597 TOB2 transducer of ERBB2, 2 2 2
MIRT574894 Plcg2 phospholipase C, gamma 2 2 7
MIRT607551 GLI2 GLI family zinc finger 2 2 2
MIRT607694 MAPK10 mitogen-activated protein kinase 10 2 2
MIRT609983 PPARA peroxisome proliferator activated receptor alpha 2 2
MIRT610076 CRLF1 cytokine receptor like factor 1 2 2
MIRT610578 CACUL1 CDK2 associated cullin domain 1 2 4
MIRT626322 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT634011 RIF1 replication timing regulatory factor 1 2 2
MIRT642680 KRT74 keratin 74 2 2
MIRT689717 ATXN2 ataxin 2 2 2
MIRT691175 APOL6 apolipoprotein L6 2 2
MIRT693169 NPR1 natriuretic peptide receptor 1 2 2
MIRT697121 OTUD5 OTU deubiquitinase 5 2 2
MIRT711817 ELN elastin 2 2
MIRT721551 FXN frataxin 2 2
MIRT721666 SLFN12 schlafen family member 12 2 2
MIRT723760 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT737362 FOXP4 forkhead box P4 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4651 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4651 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4651 Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4651 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4651 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4651 Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4651 Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4651 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4651 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-mir-4651 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4651 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4651 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4651 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4651 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-4651 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-4651 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4651 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4651 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4651 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4651 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4651 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4651 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4651 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4651 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4651 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4651 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission