>SAA1|NM_000331|3'UTR
   1 GCTTCCTCTTCACTCTGCTCTCAGGAGATCTGGCTGTGAGGCCCTCAGGGCAGGGATACAAAGCGGGGAGAGGGTACACA
  81 ATGGGTATCTAATAAATACTTAAGAGGTGGAATTTGTGGAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgGGAGGGGACUGAGGGACu 5' |:|||:|| | |:||| Target 5' -gCTTCCTCT-TCACTCTGc 3'	1 - 18	113.00	-16.60
2	miRNA 3' cggGAGGGGACU---GAGGGACU- 5' |||:| || || ||| Target 5' ctgCTCTCAGGAGATCTGGCTGTG 3'	15 - 38	81.00	-15.20

Mutant ID	Mutant Position	Mutant Source
COSN30692823	16	COSMIC
COSN31576881	34	COSMIC
COSN30520892	39	COSMIC
COSN30190365	42	COSMIC
COSN31493533	56	COSMIC
COSN30178493	65	COSMIC
COSN30502376	65	COSMIC
COSN18736230	66	COSMIC
COSN31509741	67	COSMIC
COSN30453179	68	COSMIC
COSN30490580	69	COSMIC
COSN31560933	71	COSMIC
COSN30493065	85	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1219431280	3	dbSNP
rs1271747446	9	dbSNP
rs1288448926	12	dbSNP
rs1342574994	18	dbSNP
rs1218627794	23	dbSNP
rs547627072	24	dbSNP
rs1349879594	26	dbSNP
rs183981346	31	dbSNP
rs1375428406	33	dbSNP
rs1261775321	37	dbSNP
rs1488430432	39	dbSNP
rs1445734981	41	dbSNP
rs1194834394	46	dbSNP
rs780300491	48	dbSNP
rs11821600	52	dbSNP
rs552063508	58	dbSNP
rs1452432784	65	dbSNP
rs1043319594	66	dbSNP
rs939501263	68	dbSNP
rs934797003	73	dbSNP
rs1164153813	74	dbSNP
rs1401844799	75	dbSNP
rs1053318357	77	dbSNP
rs569920581	79	dbSNP
rs1057121369	80	dbSNP
rs1157297569	82	dbSNP
rs1439491333	83	dbSNP
rs1253963644	85	dbSNP
rs895398739	86	dbSNP
rs895859549	88	dbSNP
rs1195121082	91	dbSNP
rs1466857447	92	dbSNP
rs1381662801	97	dbSNP
rs146642944	105	dbSNP
rs1229041336	107	dbSNP
rs1044026039	111	dbSNP
rs1014345287	113	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.