>IFRD1|NM_001007245|3'UTR
   1 ATTTTCAGAACTTGAAGACTATTTTCTAATTTCTATTTTTTTTTCTATTTCAATGTATTTAAACTCTAGACACAGTTTTT
  81 ATCCTGGATTAACTTAGATAACTTTTGTAGCAGTGGTTATATTGCTTATAATTTAATGTACAATACTATTGAAACTGGTG
 161 AGTTCTGATTATTAAATATTCTCTGTAAATCAGTAAACATGTATAAAGTATTTGTAATGTTTGGTCATAATTTATTTATG
 241 AAGACAGCAAAAGACTGATTTCATGATGGGGAAAACAATTAGCCAAAGTTTAATTTCTTACACTGTGGTTGTCAAGAATA
 321 CTGATTTACTATAATGATATATACATGCAAGATATTTAACTTAATATCTTAGACAAGAGTTCTGGGTACAATTTTGGGAT
 401 CTAGTTCCCCTGGAAAAGCTGCTGTATTTTTAATTTTTAATGGAATGTAGCTTTTAAAATCCTGTCACTGGCATCAACAA
 481 AAGGAATTATACCATGAGACCTTATAGCTGTACTTAAAAGCCATTCAGTTCAGCTATTGGGAGTTCATGATGAATTAGCA
 561 TATGCCAGAAAGGTTGCTAACCTTAACATCTGAGAGCAGTAACACTGATTTTATCTGCTGTATGAGACTTTGTGCATTTT
 641 ACTTTGAAATAAAGATTTTTTTCCACACTGAAAGTGCTTCTCTTCTAATAGAAGAAATATTATTTATGGCTTTGAGGTAC
 721 AGAGTCCAAAATGACTAGGCCAGGTGGGCAGGGAGACAAAGCTTTATGTGTATATTTACAAACATTAAAGTAGATGAAAA
 801 GAATGTAGCAATACATAATTGGGATTAAGGTTTCTGACTTTCAAGAATATTTCTGCTTGGCAACATGCAGTGTGGCTCAT
 881 GCCTATAATCAGCACTCTGGGGAGGCTGAGGCGGGAGGATGGCATGAGCCCAGTTTGAGACCAGCCTGGGCAACATAGCG
 961 AGACCCTGTCTCTACCAGAAATTTAAAAAATGAGTGTGGTGGTGTGTGCTTCTACTCTTTATCTACTTGGGTGCTGAGGC
1041 AAGAGGGTAACTTGAGCCCAGGAGGTCAAAGCTGCAGTGAGCCGTGATTGTGCCACTCCAGCCTGGGTGACGAGTGAGAC
1121 CTTGTCTCAAAAGCAAAACAAAAAAGAATATTGCTGCTTGTTTGCCCATGAGGTATATTTCTTTCATTTTATGAAAAGCA
1201 TTTTGACAACACGTTAACATTTAATAAACTTTAGATTAAAATATATAGTGCAAGCAACATGCCATTTCAAATCCGTAGAC
1281 TTGTTTCTTTGATACTCTTGCTGTAGGTCGCCGTGAGGGGTAGGGAAGCATATATACTGTAGGGAGAAGTATCAAAATCA
1361 TTTAAGGTCTTTTTTCCAAACTAGTGTTCCCCTCCCACATCCCAACAACTCTTGGAAGTCTGGTGCTCCCTCTAGGTGAA
1441 AATCATTTGCTGGCTTATGGAGTCACTGTTGCTGAGTCCCATCCCCCAGTTACAGTGCAGTGGAAAACAGGTTTAGAATC
1521 TAGAACTTGTTTGTATGTTGTCACTTGGTTATGTTCCAAGTAGGTTAGAACCATGGAAAAGAGATTGCAAATGGTAGTTT
1601 CTTCTAGATATTCAAATGCATATATGTATGTACATGTAATTATAAATAAATAATGAATTTTTATTAAAGTGTTGTATGAA
1681 CATAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugguuuccgucgGGACCGUUGa 5' |:||||||| Target 5' agaatatttctgCTTGGCAACa 3'	844 - 865	146.00	-12.30
2	miRNA 3' ugGUUUCCGUCGGGACCGUUGa 5' ::|: |||||: |||||| Target 5' ttTGAGACCAGCCTGGGCAACa 3'	934 - 955	136.00	-18.50
3	miRNA 3' uggUUUCCGUCGGGACCGUUGa 5' ||| ||| :::|| |||| Target 5' atgAAAAGCA-TTTTGACAACa 3'	1191 - 1211	130.00	-7.40

Mutant ID	Mutant Position	Mutant Source
COSN30146361	27	COSMIC
COSN30187259	27	COSMIC
COSN30039372	36	COSMIC
COSN20059549	45	COSMIC
COSN30129330	46	COSMIC
COSN1340715	278	COSMIC
COSN25566127	599	COSMIC
COSN26498452	743	COSMIC
COSN25565656	819	COSMIC
COSN26516449	850	COSMIC
COSN9919643	1264	COSMIC
COSN21763279	1322	COSMIC
COSN20700883	1608	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs917570510	1	dbSNP
rs1490348205	2	dbSNP
rs776074519	4	dbSNP
rs202027753	6	dbSNP
rs1197891891	8	dbSNP
rs1234775515	13	dbSNP
rs769382588	20	dbSNP
rs774979782	22	dbSNP
rs762722107	27	dbSNP
rs1355655605	30	dbSNP
rs763790237	34	dbSNP
rs1386477079	36	dbSNP
rs763386499	36	dbSNP
rs776076142	36	dbSNP
rs1457312797	37	dbSNP
rs751403442	42	dbSNP
rs761783521	45	dbSNP
rs1163833372	46	dbSNP
rs767584779	48	dbSNP
rs1384936438	49	dbSNP
rs1429504042	52	dbSNP
rs1410242774	59	dbSNP
rs539078978	60	dbSNP
rs925549686	68	dbSNP
rs1191766529	70	dbSNP
rs911920004	71	dbSNP
rs1478884694	72	dbSNP
rs557088259	79	dbSNP
rs575863882	82	dbSNP
rs7817	85	dbSNP
rs893891080	89	dbSNP
rs555125998	92	dbSNP
rs1277241700	108	dbSNP
rs1042599499	114	dbSNP
rs148530051	116	dbSNP
rs1299930904	117	dbSNP
rs1003828255	119	dbSNP
rs1035664978	120	dbSNP
rs540723869	124	dbSNP
rs1386158857	126	dbSNP
rs1365354267	127	dbSNP
rs1015449358	140	dbSNP
rs1461821570	147	dbSNP
rs1228028976	149	dbSNP
rs962621004	150	dbSNP
rs1463702252	162	dbSNP
rs995323797	181	dbSNP
rs895514715	183	dbSNP
rs1013004535	184	dbSNP
rs1214730371	184	dbSNP
rs1247725429	193	dbSNP
rs1463945290	196	dbSNP
rs1191043756	199	dbSNP
rs1022587937	200	dbSNP
rs959272666	204	dbSNP
rs188125956	206	dbSNP
rs917699624	208	dbSNP
rs973096713	211	dbSNP
rs140390189	215	dbSNP
rs1295011802	225	dbSNP
rs1026132459	228	dbSNP
rs1424456598	228	dbSNP
rs1309924311	241	dbSNP
rs977770413	246	dbSNP
rs767778239	255	dbSNP
rs1462659494	263	dbSNP
rs925496081	266	dbSNP
rs1375945752	268	dbSNP
rs1328985830	272	dbSNP
rs936914491	277	dbSNP
rs753117904	279	dbSNP
rs922092095	280	dbSNP
rs1464657339	288	dbSNP
rs1396960819	290	dbSNP
rs532871332	303	dbSNP
rs1236750488	305	dbSNP
rs1387556210	311	dbSNP
rs1432880497	312	dbSNP
rs1439194554	314	dbSNP
rs1250717134	322	dbSNP
rs1320200290	323	dbSNP
rs1342318201	330	dbSNP
rs987446634	332	dbSNP
rs911791834	334	dbSNP
rs1352845918	343	dbSNP
rs142885492	344	dbSNP
rs975152435	345	dbSNP
rs151068777	346	dbSNP
rs1004818097	348	dbSNP
rs1377405192	353	dbSNP
rs1282452058	359	dbSNP
rs1298957404	361	dbSNP
rs547042202	364	dbSNP
rs1037681087	365	dbSNP
rs898386500	368	dbSNP
rs1160666440	372	dbSNP
rs995824643	380	dbSNP
rs1368226930	381	dbSNP
rs778290830	382	dbSNP
rs35930058	386	dbSNP
rs1259044093	387	dbSNP
rs1042484205	388	dbSNP
rs1234068322	391	dbSNP
rs1283870844	396	dbSNP
rs924130777	398	dbSNP
rs539197413	402	dbSNP
rs1327525049	403	dbSNP
rs182862360	417	dbSNP
rs1263019725	431	dbSNP
rs1293984703	435	dbSNP
rs1399415515	438	dbSNP
rs567434122	448	dbSNP
rs1320901874	461	dbSNP
rs1401774779	464	dbSNP
rs1442303566	465	dbSNP
rs1012475284	471	dbSNP
rs1044467643	472	dbSNP
rs1024706088	506	dbSNP
rs140916921	528	dbSNP
rs746077999	529	dbSNP
rs1188206358	536	dbSNP
rs994568412	537	dbSNP
rs1026016323	538	dbSNP
rs1188201771	549	dbSNP
rs950588656	554	dbSNP
rs1411042488	557	dbSNP
rs1009155713	561	dbSNP
rs977718403	563	dbSNP
rs1447460654	582	dbSNP
rs547109732	583	dbSNP
rs1385609135	587	dbSNP
rs1413796429	590	dbSNP
rs1018741755	598	dbSNP
rs1338588416	601	dbSNP
rs571730889	616	dbSNP
rs539141556	621	dbSNP
rs550915652	622	dbSNP
rs187936088	623	dbSNP
rs7467	625	dbSNP
rs974661231	631	dbSNP
rs555008073	637	dbSNP
rs933468733	637	dbSNP
rs1416798462	649	dbSNP
rs1187724460	656	dbSNP
rs1475700986	664	dbSNP
rs1245993081	667	dbSNP
rs3183621	668	dbSNP
rs1469702131	669	dbSNP
rs1344933404	674	dbSNP
rs1198279963	675	dbSNP
rs1199182630	678	dbSNP
rs1275211979	690	dbSNP
rs1275959517	698	dbSNP
rs534086692	705	dbSNP
rs748009871	722	dbSNP
rs1273653727	725	dbSNP
rs1250583958	732	dbSNP
rs978213364	743	dbSNP
rs1471376561	744	dbSNP
rs1183762352	745	dbSNP
rs558727921	748	dbSNP
rs1372243390	758	dbSNP
rs1364092471	769	dbSNP
rs573026105	770	dbSNP
rs577289441	773	dbSNP
rs28617497	775	dbSNP
rs1377395252	776	dbSNP
rs1037787706	777	dbSNP
rs1171744621	780	dbSNP
rs1435396483	780	dbSNP
rs1455498323	787	dbSNP
rs1253431670	798	dbSNP
rs1307448923	811	dbSNP
rs1177711433	812	dbSNP
rs939411202	814	dbSNP
rs899160978	820	dbSNP
rs1368986499	824	dbSNP
rs563279547	826	dbSNP
rs1393297712	831	dbSNP
rs1205485673	834	dbSNP
rs1441959866	843	dbSNP
rs1308172052	845	dbSNP
rs1330868148	847	dbSNP
rs1057050100	864	dbSNP
rs575160389	866	dbSNP
rs1308990451	867	dbSNP
rs1222367105	870	dbSNP
rs916724330	880	dbSNP
rs1349480227	882	dbSNP
rs1299593594	890	dbSNP
rs1442440822	896	dbSNP
rs1358095623	905	dbSNP
rs542905662	909	dbSNP
rs1211004336	911	dbSNP
rs948332957	913	dbSNP
rs1436511709	914	dbSNP
rs1273230793	916	dbSNP
rs1157964415	927	dbSNP
rs1417156711	929	dbSNP
rs1409852050	931	dbSNP
rs12532648	934	dbSNP
rs1472561821	935	dbSNP
rs1038599803	942	dbSNP
rs1013807592	945	dbSNP
rs1213026854	953	dbSNP
rs773316408	960	dbSNP
rs1251057767	961	dbSNP
rs2190587	964	dbSNP
rs994454979	965	dbSNP
rs1214269417	968	dbSNP
rs192495763	973	dbSNP
rs999274122	976	dbSNP
rs1354359072	977	dbSNP
rs202245202	978	dbSNP
rs1290918855	991	dbSNP
rs1032128018	995	dbSNP
rs1375520849	996	dbSNP
rs565101323	1003	dbSNP
rs1454632133	1015	dbSNP
rs1159510229	1022	dbSNP
rs974459379	1030	dbSNP
rs1415875477	1036	dbSNP
rs373471638	1039	dbSNP
rs1388343848	1043	dbSNP
rs532634593	1048	dbSNP
rs375971853	1054	dbSNP
rs1463770947	1059	dbSNP
rs1029637442	1060	dbSNP
rs150195951	1066	dbSNP
rs1185334561	1073	dbSNP
rs765822442	1076	dbSNP
rs1019209963	1084	dbSNP
rs964564771	1085	dbSNP
rs2190588	1086	dbSNP
rs1328283179	1087	dbSNP
rs1022220749	1096	dbSNP
rs1372400232	1103	dbSNP
rs1228224583	1105	dbSNP
rs12532656	1112	dbSNP
rs1305253150	1113	dbSNP
rs183963470	1119	dbSNP
rs1294172202	1124	dbSNP
rs1229207935	1129	dbSNP
rs1030982033	1133	dbSNP
rs1251507809	1135	dbSNP
rs1204003843	1139	dbSNP
rs1289240926	1140	dbSNP
rs1363901468	1140	dbSNP
rs1460780692	1141	dbSNP
rs1392010352	1142	dbSNP
rs920713672	1143	dbSNP
rs937313647	1147	dbSNP
rs1423049468	1149	dbSNP
rs1168332806	1153	dbSNP
rs1211626053	1154	dbSNP
rs566774817	1173	dbSNP
rs11763010	1174	dbSNP
rs753028238	1175	dbSNP
rs1191122942	1176	dbSNP
rs1467450578	1177	dbSNP
rs1255263608	1178	dbSNP
rs1215204969	1187	dbSNP
rs1468873906	1205	dbSNP
rs1187832145	1213	dbSNP
rs916757478	1214	dbSNP
rs1308731500	1226	dbSNP
rs1425060038	1229	dbSNP
rs895020175	1233	dbSNP
rs1430349710	1237	dbSNP
rs1440040483	1247	dbSNP
rs1368577367	1252	dbSNP
rs189088158	1253	dbSNP
rs1395971016	1254	dbSNP
rs146502731	1256	dbSNP
rs1463653444	1260	dbSNP
rs1373690525	1261	dbSNP
rs192986341	1275	dbSNP
rs556826778	1276	dbSNP
rs1397304192	1287	dbSNP
rs1167556244	1290	dbSNP
rs761056552	1296	dbSNP
rs1395599521	1298	dbSNP
rs1249446783	1300	dbSNP
rs920186324	1310	dbSNP
rs1193713378	1311	dbSNP
rs371583525	1313	dbSNP
rs1047405243	1315	dbSNP
rs542220995	1318	dbSNP
rs1233501347	1321	dbSNP
rs1345563008	1325	dbSNP
rs1305376880	1336	dbSNP
rs1234826349	1338	dbSNP
rs1334944046	1339	dbSNP
rs1327156521	1340	dbSNP
rs1032077171	1351	dbSNP
rs1393343213	1360	dbSNP
rs1397334643	1362	dbSNP
rs1312313851	1365	dbSNP
rs115833997	1367	dbSNP
rs944483899	1369	dbSNP
rs1040106360	1370	dbSNP
rs900374840	1383	dbSNP
rs1470003510	1387	dbSNP
rs1362390100	1389	dbSNP
rs1179283288	1390	dbSNP
rs116476758	1391	dbSNP
rs1209459426	1397	dbSNP
rs1009093211	1400	dbSNP
rs1054043	1407	dbSNP
rs903788170	1416	dbSNP
rs999413191	1419	dbSNP
rs1349753659	1428	dbSNP
rs778849569	1435	dbSNP
rs962165221	1446	dbSNP
rs774795399	1450	dbSNP
rs1336506489	1455	dbSNP
rs565049962	1466	dbSNP
rs1413071798	1467	dbSNP
rs377707545	1467	dbSNP
rs572720088	1467	dbSNP
rs992690466	1472	dbSNP
rs1335227658	1473	dbSNP
rs1400614279	1481	dbSNP
rs1383286499	1485	dbSNP
rs1160616145	1486	dbSNP
rs532250908	1489	dbSNP
rs1455038157	1492	dbSNP
rs1412332108	1495	dbSNP
rs551042295	1501	dbSNP
rs1186778384	1504	dbSNP
rs1473963222	1527	dbSNP
rs1188197475	1529	dbSNP
rs1446318091	1539	dbSNP
rs1208070499	1540	dbSNP
rs1258867183	1541	dbSNP
rs958824023	1549	dbSNP
rs1383927777	1551	dbSNP
rs1351109493	1555	dbSNP
rs991859369	1564	dbSNP
rs917254194	1565	dbSNP
rs950065303	1571	dbSNP
rs1293933032	1578	dbSNP
rs184852685	1585	dbSNP
rs1255476952	1596	dbSNP
rs923878763	1599	dbSNP
rs1474356596	1603	dbSNP
rs935129143	1604	dbSNP
rs969843907	1605	dbSNP
rs1459506142	1606	dbSNP
rs893513496	1610	dbSNP
rs530213771	1623	dbSNP
rs548260337	1624	dbSNP
rs1475049372	1626	dbSNP
rs1240340789	1633	dbSNP
rs974214782	1635	dbSNP
rs1195227691	1642	dbSNP
rs1457025934	1643	dbSNP
rs1252123272	1651	dbSNP
rs563891952	1657	dbSNP
rs758530137	1658	dbSNP
rs1212079878	1659	dbSNP
rs995945248	1660	dbSNP
rs1157337638	1666	dbSNP
rs1347499334	1670	dbSNP
rs1214120234	1672	dbSNP
rs1267532658	1675	dbSNP
rs566542862	1677	dbSNP
rs1489005513	1678	dbSNP
rs117516932	1683	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.