miRTarBase - #MIRT453911


—
pre-miRNA Information
pre-miRNA hsa-mir-1247   
Genomic Coordinates chr14: 101560287 - 101560422
Synonyms MIRN1247, hsa-mir-1247, MIR1247
Description Homo sapiens miR-1247 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1247-3p
Sequence 74| CCCCGGGAACGUCGAGACUGGAGC |97
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs765946490 1 dbSNP
rs1167774642 3 dbSNP
rs369874810 4 dbSNP
rs1295169065 5 dbSNP
rs1368557653 7 dbSNP
rs375254504 10 dbSNP
rs1049152389 16 dbSNP
rs774601647 21 dbSNP
rs1317190334 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GABRR2   
Synonyms -
Description gamma-aminobutyric acid type A receptor rho2 subunit
Transcript NM_002043   
Expression
Putative miRNA Targets on GABRR2
3'UTR of GABRR2
(miRNA target sites are highlighted)		 
>GABRR2|NM_002043|3'UTR
   1 GGGCTCCAAGGCTGTTCCTAGAAGAGGGCATAGACATCGAGGGGGCCTGGCCAGTCATTGACAGACGGACTTGTTGACCA
  81 CACGCCCCTCACCAAACAATGCAGCAGCTACTGGACCACCCTGAGCAGCACTCATCTCTCAGAGAAGCCCAGGAGCCTTC
 161 CAGCTGCCCTGACCCCAGACCCCGTGGGGCTGCTCCATGTTCATGCTGTCTCGCGTCACACTTCACATCTCTCTGGGACC
 241 TTCTGTTCTTGTGTGTGAACTAATTCACAAGAACTCCCCTCCTATAAACAAGGATTCAAATGCCTCCTAGACATTCTTAG
 321 ACCCTCAGATTGCCTAGGAGTCAGTTGTGGAGGGAAAAGGAAAAACTGAAGTACAAGCTTAGGGGCATTCTGGATAGGAG
 401 ATAGGAAATTAAGAACAAAAAACACCCTGTAAACCCATTGAACTTGATTAAGTGCCTACCTAGAAGGGAAAAGAGCTGAG
 481 ATCCCAGACAGGAAATGATTTGGCCTGTGGGAGTATGGCAACCCACAGGATTCTGCAATATTAGAGGAGATTATTCATTT
 561 ATCCATCCATTCAACCATTCATTAAATATTGAGGTCCCACTCTGTGCCAGGTACGGTAGAAATGAGAAAATAGTCTCTTT
 641 CCTTAGAGATCTTCTCTAAGTTGTGCTCATTCTACATATGGCATGATGTACTTCTGCTCTTTCCCCTCCTTCAACCCCGC
 721 TTACCCCACAGACCCATTCTGTTTGCTGTTGCTTTTACTCTTAGGCATATAAGGCAGGGTCCAGGAGAGGCCAGGTCCAG
 801 AACTTTCAACTATCCTCCTCCAGTGAAGTTACACAGATAGCACTAATTTTGCCCAGCAATGACATGTAGCAATGTGCATG
 881 GAGTATTGCCAGCCAGAGAAACTTACCCAGGCTCACCACGGTGTACAGTTTTTTTATTGGGGTCGGTCATGGATTTATAG
 961 CTGATTGCCCACATGGCTGACTTTAGTCTTTTGCCCCTCCAGAGGTTAAGCTGGTACCTTGAGGTCCAGGGCACCTATCA
1041 TAAATCACATTGTTGGCATAGACTATCTGGTGTGGCCCAAGGCCCCAGTAGACAAAGACCCTTCTATCTCACAGGACATT
1121 CCAAGGGCATAGAGGTTGCTTCCTAGTAAAGGTTAGTCCTTTACTACACAGCAACTCTTGTCAATTCCCTATTGTTAATG
1201 TTAATTGCGGTGTTACTATTATATATTCAGGCAATAAACATTTTAAAGTATCTCTGCACTAGGTACATTGGGGTCCAAAT
1281 TAAGAATAAGAGTAGTCGAAGCTCTCAGAGAAGGAACTAGTAAAGGAAATACCACACAAATATCTATAATATAAGATTAA
1361 GAGTGTTTAGTGCCTCAGTAATAGTTCAGTGTGAGATGGGAATTCCAAGGGAGGAAAAACAGTCCCACCAGGGAGACAGA
1441 CCTCATGGAGAAAGCAGCCCTGAGATGCCCCTTGAAGGTCAGGATTTTAAGAAGAAGAAATGGAGCAGAATGCATCCTAG
1521 ATCTGGGCTGTCTCATATGGTAGCCACTAGCCACATGTCTATTTAAATTTAAATTAGTAAAAATTAAAAATATTAGCCAG
1601 GTGTGGTGGTGTGTGCCTGGGGTTCTAGCTACTCAGGAGGCTGAGGCGGGAGGATTGCTTGAGCCCAGGAATTCCAGGCT
1681 GCCGTGAGCTGTGATCAAGCCACTGCAGTCCAGCCTGAGTGACAGAGCGAGACCCTATCTCTAAAATAATAATTATTATT
1761 ATTTAAATTAGTTGAAGTTAAATAAAATTGAAAACTCAGTTCCTTGGTTACACCATCCACACTCAAGTGGGCTTAGTAAG
1841 CACAGTTGCTAGTAGCTACTGCACTGGGCTGGGCAGCCTAAAGACCAGGAAGCTCTACCAGCCAAGAGACCAGCTTGAGC
1921 GGACGCATGGGGAGAATGGGAAGGTTTGCCATTGCAGAGAACAGGGTTTGTGGGCAAGTCATTCATTTTGGCAGGATCCT
2001 AGGCTGTGATAAGAGGAGGTGAGCGACTAGCTTTTTCCACAACACTAGGGATCAAGGCAGGTCCCCACCATGCCGGTGCT
2081 TATGAGGACAGCTTCCCCACTATGGAGTTGCTGGACCCAAGACTACTAGATTTCCCAGTCTCACAGACCAATGAAGAACA
2161 AAAATGCATAAATATGGGTAATTGGGTGGTACAGGGCATCTGGACTTGTTTAGAAACCTTTTTTTCTTTTCTGAGACAGA
2241 GTTTCACTCTTGTTGCTCAGGCTGGAGTGCAATGGCTTGATCTTGGCTCACCACAACCTCTGCCTCCCGGGTTCAAGCAA
2321 TTCTCCTGCCTCAGCCCTGGAGTAGCTGGGATTACAGGCATGCGCCACCATGCCTGGCTAACTTTTGTATTTTTTAGTAG
2401 AGATGGGGTTTCTCCATGTTAGTCAGCCTGGTCTTGAACTCCTGACCTCAGGTGATCCGCCTGCCTCAGCCTCCCAAAGT
2481 GCTGTGATTACAGGCGTGAGCCACCACACCCGGCCAGAAACCTTTTATCTATAGAGACTCTCCCAGGCCACAGTGCTGCT
2561 CGAAGAATGATAATTCTATTGTCATTAAATATATCATATTGCTTTGCTTGTAAGTCTTATTTAATTCCAACCCTTCTCTG
2641 CTTCTGACTGCATTGTTTTCATGCATTATGGCTCATATAACATAGTTGCCTGTTCACAAATTAAAACAAATATTTATTTT
2721 TGCTAGCTTCTATGTTAAACTGGAGTTAATTCTATAGCAGACATATTTAGAATCATAAACAGTGTTTTATCATGCAGGGC
2801 CATGATACAATGACACCATTGTATTTAGCATTGCCTTATTACAGTATACTAGTCTGACACTACTTGAGAAAAGTAGGAAA
2881 TTTAAAGAGGTAAAGTGGAGACAACATTGGTAGGAGTAGAAAACAGGAACTAAGGAAATAGTGAGAACATGGGATGATTC
2961 ACCCTGGAGGCAGGAAGACAGAGAAGCAAACACAATTGTTATCAGGAATGCATGAATGATACTTTACTTCACTGAATCTA
3041 AGACATGGTGAAATGTAAGATGCACCCATATTTTATGTACTGAGAAAAAATACTAACAATCAAATTCTGGAATGCCAATG
3121 ATTATAATATGAATCCTGATTTCACCAATATGAAACTGTGAAAAAATGTTAATGTTACAATAAAAGAAATGGGTTTTATA
3201 CAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgagGUCAGAGCUGCAAGGGCCCc 5'
              ||  ||| :|  ||||||| 
Target 5' accaCAACCTCTGC-CTCCCGGGt 3'
 2290 - 2312 151.00 -18.60
2 
miRNA  3' cgaGGUCA--GAGCUGCAAGGGCCCc 5'
             |::||  ||:|| | ||| ||| 
Target 5' aagCTGGTACCTTGA-GGTCCAGGGc 3'
 1008 - 1032 130.00 -19.50
3 
miRNA  3' cgAGGUCAGAGCUGCAAGGGCCCc 5'
            ||:| |   |||  |||| || 
Target 5' taTCTA-TAGAGACTCTCCCAGGc 3'
 2526 - 2548 121.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31505159 2 COSMIC
COSN30464607 28 COSMIC
COSN31578086 39 COSMIC
COSN20075642 84 COSMIC
COSN31567022 119 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs894852881 3 dbSNP
rs758588617 4 dbSNP
rs1185422310 5 dbSNP
rs1463608107 7 dbSNP
rs750635955 11 dbSNP
rs1216809441 13 dbSNP
rs56225722 14 dbSNP
rs1243122421 15 dbSNP
rs762123817 16 dbSNP
rs1228242503 19 dbSNP
rs754357842 24 dbSNP
rs764644226 28 dbSNP
rs758162386 29 dbSNP
rs761240859 29 dbSNP
rs752501975 31 dbSNP
rs774903809 37 dbSNP
rs1178589401 38 dbSNP
rs1320765888 39 dbSNP
rs1432517221 43 dbSNP
rs1347886962 44 dbSNP
rs771593200 45 dbSNP
rs961067748 50 dbSNP
rs1290812022 58 dbSNP
rs1036844952 66 dbSNP
rs1016860444 73 dbSNP
rs879764271 80 dbSNP
rs1224825621 83 dbSNP
rs1280876158 85 dbSNP
rs189240348 86 dbSNP
rs111836357 90 dbSNP
rs1229545795 92 dbSNP
rs1285886780 97 dbSNP
rs943880073 114 dbSNP
rs911936680 120 dbSNP
rs1005435788 123 dbSNP
rs1214849634 125 dbSNP
rs1051834197 133 dbSNP
rs1014107861 134 dbSNP
rs1407080102 137 dbSNP
rs570891243 140 dbSNP
rs1323747991 149 dbSNP
rs921983922 150 dbSNP
rs990121397 152 dbSNP
rs1056506975 160 dbSNP
rs559103645 166 dbSNP
rs1382098967 168 dbSNP
rs1160828124 171 dbSNP
rs80157952 174 dbSNP
rs1366129902 177 dbSNP
rs1406766188 179 dbSNP
rs1043714987 180 dbSNP
rs911494553 183 dbSNP
rs77466577 184 dbSNP
rs1348012447 187 dbSNP
rs934203758 190 dbSNP
rs1174226300 194 dbSNP
rs970888303 197 dbSNP
rs1285834500 204 dbSNP
rs770771767 208 dbSNP
rs142739923 213 dbSNP
rs775584522 214 dbSNP
rs1012039389 215 dbSNP
rs1365763891 227 dbSNP
rs1438001046 238 dbSNP
rs1158268587 240 dbSNP
rs959016292 248 dbSNP
rs1247119975 258 dbSNP
rs1426289944 277 dbSNP
rs961121392 292 dbSNP
rs1026677384 293 dbSNP
rs1391465833 303 dbSNP
rs769641327 306 dbSNP
rs1445566412 308 dbSNP
rs536937965 322 dbSNP
rs529578115 323 dbSNP
rs970356877 324 dbSNP
rs1022905430 328 dbSNP
rs112259446 336 dbSNP
rs1315278679 345 dbSNP
rs1360680792 346 dbSNP
rs1248564356 362 dbSNP
rs897034319 374 dbSNP
rs1322929474 384 dbSNP
rs959938172 385 dbSNP
rs1196470367 386 dbSNP
rs1252824544 394 dbSNP
rs1261767576 405 dbSNP
rs1456473741 408 dbSNP
rs1178312381 413 dbSNP
rs1243921627 417 dbSNP
rs1221452809 423 dbSNP
rs1037357015 426 dbSNP
rs1031467432 437 dbSNP
rs999531401 438 dbSNP
rs1270018891 448 dbSNP
rs1397556334 450 dbSNP
rs1008010181 458 dbSNP
rs890990312 459 dbSNP
rs1429584432 466 dbSNP
rs1464630795 468 dbSNP
rs1381565007 474 dbSNP
rs1303816889 475 dbSNP
rs1384493427 482 dbSNP
rs1324381858 483 dbSNP
rs1398163207 484 dbSNP
rs902618492 489 dbSNP
rs1228842186 494 dbSNP
rs1022227476 496 dbSNP
rs184670304 505 dbSNP
rs1010928650 515 dbSNP
rs1322151499 517 dbSNP
rs1263990858 522 dbSNP
rs1051783572 529 dbSNP
rs932091732 531 dbSNP
rs781008548 532 dbSNP
rs1053763486 538 dbSNP
rs1428866946 540 dbSNP
rs1404749595 547 dbSNP
rs1174155477 550 dbSNP
rs1464679932 567 dbSNP
rs1176434740 571 dbSNP
rs757028192 575 dbSNP
rs1464284088 576 dbSNP
rs1301894158 583 dbSNP
rs1402001679 586 dbSNP
rs936676016 587 dbSNP
rs547941106 592 dbSNP
rs1416145055 597 dbSNP
rs376463584 598 dbSNP
rs901305371 600 dbSNP
rs192335428 602 dbSNP
rs113424515 610 dbSNP
rs112141392 614 dbSNP
rs144566309 615 dbSNP
rs1255609368 620 dbSNP
rs948443269 624 dbSNP
rs990552518 633 dbSNP
rs959089567 634 dbSNP
rs1189494561 637 dbSNP
rs915810399 641 dbSNP
rs149713369 645 dbSNP
rs1241409218 651 dbSNP
rs4707534 656 dbSNP
rs1430927009 681 dbSNP
rs1174941466 687 dbSNP
rs973723097 691 dbSNP
rs1454634907 700 dbSNP
rs1212818019 702 dbSNP
rs1359004094 712 dbSNP
rs1399997138 716 dbSNP
rs1304245579 717 dbSNP
rs1443563612 718 dbSNP
rs752160185 723 dbSNP
rs562935307 727 dbSNP
rs282130 734 dbSNP
rs1242068024 748 dbSNP
rs1283693703 749 dbSNP
rs977241235 750 dbSNP
rs966745814 755 dbSNP
rs574653585 763 dbSNP
rs1228750277 764 dbSNP
rs573686353 773 dbSNP
rs1487236124 785 dbSNP
rs1008126035 789 dbSNP
rs1381365326 793 dbSNP
rs1334201447 796 dbSNP
rs1450115745 808 dbSNP
rs1359617148 812 dbSNP
rs530911776 815 dbSNP
rs1190055314 817 dbSNP
rs1022363362 823 dbSNP
rs559405003 827 dbSNP
rs890940173 830 dbSNP
rs1028087980 831 dbSNP
rs996648603 842 dbSNP
rs1416589118 845 dbSNP
rs1407967606 859 dbSNP
rs900549087 860 dbSNP
rs1054283058 864 dbSNP
rs1352087415 867 dbSNP
rs756607091 870 dbSNP
rs1434411971 874 dbSNP
rs1292957189 875 dbSNP
rs889834033 896 dbSNP
rs867775770 904 dbSNP
rs1449365588 909 dbSNP
rs1372197915 919 dbSNP
rs541180736 920 dbSNP
rs902547974 929 dbSNP
rs1291941095 936 dbSNP
rs768041188 937 dbSNP
rs901441191 938 dbSNP
rs186667081 945 dbSNP
rs949641458 948 dbSNP
rs918193946 950 dbSNP
rs1176444655 951 dbSNP
rs75568960 958 dbSNP
rs1439507858 959 dbSNP
rs1184526824 961 dbSNP
rs888185528 975 dbSNP
rs938178636 977 dbSNP
rs561618074 985 dbSNP
rs1164686370 1004 dbSNP
rs558836734 1020 dbSNP
rs1467229671 1026 dbSNP
rs948476849 1029 dbSNP
rs1329596484 1031 dbSNP
rs1376347926 1037 dbSNP
rs1205425476 1038 dbSNP
rs919680786 1040 dbSNP
rs1310158438 1050 dbSNP
rs113296149 1053 dbSNP
rs1227707788 1060 dbSNP
rs1273600322 1070 dbSNP
rs1319418033 1073 dbSNP
rs992916319 1075 dbSNP
rs1257041670 1086 dbSNP
rs938578037 1089 dbSNP
rs1278837431 1112 dbSNP
rs961058305 1123 dbSNP
rs1471997582 1125 dbSNP
rs1015236600 1133 dbSNP
rs1424914620 1136 dbSNP
rs924552049 1138 dbSNP
rs372554116 1151 dbSNP
rs1168551713 1157 dbSNP
rs182111855 1163 dbSNP
rs955262281 1165 dbSNP
rs1028203961 1166 dbSNP
rs996596866 1169 dbSNP
rs1357260432 1173 dbSNP
rs968555242 1178 dbSNP
rs1308477286 1179 dbSNP
rs564205524 1181 dbSNP
rs1424243281 1183 dbSNP
rs764238649 1184 dbSNP
rs989542773 1193 dbSNP
rs1032420455 1199 dbSNP
rs763186236 1208 dbSNP
rs902495449 1209 dbSNP
rs139877535 1210 dbSNP
rs191488314 1223 dbSNP
rs896707679 1238 dbSNP
rs540712107 1239 dbSNP
rs547782622 1240 dbSNP
rs1004377943 1251 dbSNP
rs1174555742 1266 dbSNP
rs1489962396 1273 dbSNP
rs1423281867 1285 dbSNP
rs1413707924 1286 dbSNP
rs888575091 1289 dbSNP
rs376844779 1297 dbSNP
rs1398146184 1298 dbSNP
rs1297472170 1304 dbSNP
rs1345650508 1316 dbSNP
rs1234724527 1319 dbSNP
rs1012638360 1320 dbSNP
rs1343774884 1322 dbSNP
rs920115256 1324 dbSNP
rs1287275017 1334 dbSNP
rs1038103298 1342 dbSNP
rs1489455611 1350 dbSNP
rs1215142941 1351 dbSNP
rs145959468 1358 dbSNP
rs938377562 1363 dbSNP
rs924521016 1367 dbSNP
rs117234404 1376 dbSNP
rs1477858241 1377 dbSNP
rs1159475035 1378 dbSNP
rs986395628 1400 dbSNP
rs955044023 1414 dbSNP
rs775464399 1420 dbSNP
rs1352324873 1430 dbSNP
rs1417609686 1436 dbSNP
rs947309949 1439 dbSNP
rs1391316531 1441 dbSNP
rs769890390 1444 dbSNP
rs1404036267 1474 dbSNP
rs1365268551 1478 dbSNP
rs914378997 1497 dbSNP
rs957215401 1510 dbSNP
rs781554199 1514 dbSNP
rs1295457515 1516 dbSNP
rs1356317452 1523 dbSNP
rs1033285205 1534 dbSNP
rs550002388 1549 dbSNP
rs1437507195 1555 dbSNP
rs998719441 1558 dbSNP
rs1157107780 1561 dbSNP
rs1212143065 1571 dbSNP
rs1458896939 1573 dbSNP
rs1413252873 1577 dbSNP
rs282131 1579 dbSNP
rs1479631191 1600 dbSNP
rs1269970911 1602 dbSNP
rs1437629506 1611 dbSNP
rs1021060616 1614 dbSNP
rs1177713832 1617 dbSNP
rs954132298 1620 dbSNP
rs1459440814 1628 dbSNP
rs563071194 1630 dbSNP
rs1161360366 1635 dbSNP
rs1389444609 1640 dbSNP
rs776538340 1647 dbSNP
rs1488643278 1648 dbSNP
rs1374110664 1655 dbSNP
rs1445048681 1659 dbSNP
rs1306813728 1664 dbSNP
rs921375463 1665 dbSNP
rs548139806 1671 dbSNP
rs1282922673 1674 dbSNP
rs1355759377 1676 dbSNP
rs868056479 1683 dbSNP
rs1002890273 1684 dbSNP
rs1268644729 1687 dbSNP
rs898765373 1688 dbSNP
rs572233148 1709 dbSNP
rs1015853002 1710 dbSNP
rs1004432198 1715 dbSNP
rs1222849886 1716 dbSNP
rs1477862897 1721 dbSNP
rs1172118184 1725 dbSNP
rs1310186630 1727 dbSNP
rs1038914664 1728 dbSNP
rs1220021729 1729 dbSNP
rs953088380 1734 dbSNP
rs1398108005 1737 dbSNP
rs1027129407 1738 dbSNP
rs1013522658 1751 dbSNP
rs1361459583 1753 dbSNP
rs1280248780 1754 dbSNP
rs142362429 1754 dbSNP
rs908260233 1758 dbSNP
rs1437313738 1776 dbSNP
rs1256760401 1788 dbSNP
rs1389492295 1806 dbSNP
rs1334038054 1813 dbSNP
rs1057317190 1818 dbSNP
rs1465022651 1820 dbSNP
rs1255400046 1821 dbSNP
rs1050841195 1824 dbSNP
rs1195748385 1829 dbSNP
rs1420892292 1835 dbSNP
rs1177327522 1850 dbSNP
rs187922166 1858 dbSNP
rs1418270338 1860 dbSNP
rs540985148 1867 dbSNP
rs1467908142 1878 dbSNP
rs947278633 1880 dbSNP
rs975339377 1893 dbSNP
rs1248160380 1894 dbSNP
rs914493638 1904 dbSNP
rs1300557996 1910 dbSNP
rs1338543482 1914 dbSNP
rs577251040 1921 dbSNP
rs931839346 1924 dbSNP
rs921353022 1925 dbSNP
rs1231317474 1926 dbSNP
rs1279429347 1932 dbSNP
rs925907034 1938 dbSNP
rs944111330 1940 dbSNP
rs1260877871 1952 dbSNP
rs565060393 1956 dbSNP
rs543672428 1963 dbSNP
rs1269040311 1970 dbSNP
rs1295610068 1988 dbSNP
rs1174874248 1995 dbSNP
rs1021039699 2003 dbSNP
rs576579995 2008 dbSNP
rs952973168 2010 dbSNP
rs1013703026 2012 dbSNP
rs1359111197 2015 dbSNP
rs960676918 2017 dbSNP
rs1027677701 2020 dbSNP
rs1034071875 2024 dbSNP
rs1369816074 2025 dbSNP
rs1002222978 2028 dbSNP
rs554779284 2038 dbSNP
rs1404910965 2039 dbSNP
rs746808954 2044 dbSNP
rs536606099 2049 dbSNP
rs1303942086 2053 dbSNP
rs1242004906 2054 dbSNP
rs959167606 2062 dbSNP
rs1035822025 2072 dbSNP
rs1222203938 2073 dbSNP
rs376363295 2074 dbSNP
rs117164378 2075 dbSNP
rs902954045 2082 dbSNP
rs1450986880 2114 dbSNP
rs1238361273 2115 dbSNP
rs887311870 2126 dbSNP
rs1440703970 2127 dbSNP
rs1019884247 2137 dbSNP
rs1050789295 2142 dbSNP
rs1421545878 2144 dbSNP
rs1258129728 2151 dbSNP
rs893042884 2152 dbSNP
rs1480172591 2157 dbSNP
rs535713413 2159 dbSNP
rs778325939 2161 dbSNP
rs901635258 2162 dbSNP
rs1207560117 2168 dbSNP
rs1343216186 2172 dbSNP
rs80077539 2174 dbSNP
rs1306883997 2175 dbSNP
rs1372302033 2175 dbSNP
rs1242616523 2182 dbSNP
rs1228865714 2186 dbSNP
rs1314712560 2188 dbSNP
rs935690651 2189 dbSNP
rs1342376443 2190 dbSNP
rs925825288 2195 dbSNP
rs754487001 2197 dbSNP
rs977397541 2200 dbSNP
rs1458856987 2203 dbSNP
rs1196359441 2206 dbSNP
rs1242637179 2209 dbSNP
rs1348983576 2216 dbSNP
rs931340313 2218 dbSNP
rs1182977906 2219 dbSNP
rs1310301589 2226 dbSNP
rs1422143160 2236 dbSNP
rs945847926 2238 dbSNP
rs1370717642 2241 dbSNP
rs917108696 2249 dbSNP
rs1329533626 2250 dbSNP
rs992111251 2259 dbSNP
rs1369743271 2280 dbSNP
rs1188124219 2282 dbSNP
rs1472259921 2286 dbSNP
rs1304513327 2297 dbSNP
rs1376812601 2300 dbSNP
rs111742029 2301 dbSNP
rs1278350734 2305 dbSNP
rs1319343275 2306 dbSNP
rs1184015110 2308 dbSNP
rs960752334 2309 dbSNP
rs1483264846 2311 dbSNP
rs1437646245 2318 dbSNP
rs1033775550 2320 dbSNP
rs1035792622 2324 dbSNP
rs1485012076 2326 dbSNP
rs981140527 2327 dbSNP
rs1358536435 2335 dbSNP
rs556109985 2336 dbSNP
rs1424481673 2344 dbSNP
rs1478814403 2345 dbSNP
rs967083703 2361 dbSNP
rs781763241 2363 dbSNP
rs183785436 2364 dbSNP
rs1357206562 2365 dbSNP
rs1414133726 2366 dbSNP
rs1327628603 2369 dbSNP
rs892834786 2370 dbSNP
rs1028662401 2387 dbSNP
rs1269235113 2388 dbSNP
rs750667922 2396 dbSNP
rs1410778336 2398 dbSNP
rs555406203 2399 dbSNP
rs1029762431 2407 dbSNP
rs765407530 2425 dbSNP
rs1384753324 2431 dbSNP
rs1210822032 2437 dbSNP
rs1392249912 2440 dbSNP
rs1040210726 2442 dbSNP
rs113250213 2443 dbSNP
rs1039460474 2448 dbSNP
rs141599306 2458 dbSNP
rs191574338 2463 dbSNP
rs931415472 2470 dbSNP
rs1472768694 2484 dbSNP
rs186571944 2495 dbSNP
rs112748993 2496 dbSNP
rs937567081 2505 dbSNP
rs917182262 2510 dbSNP
rs368136146 2511 dbSNP
rs143352296 2512 dbSNP
rs1438224265 2514 dbSNP
rs565201855 2521 dbSNP
rs1369279937 2524 dbSNP
rs980912942 2527 dbSNP
rs967555873 2529 dbSNP
rs963020152 2531 dbSNP
rs1270522509 2535 dbSNP
rs1203892583 2545 dbSNP
rs1229596756 2546 dbSNP
rs1452229099 2547 dbSNP
rs1201310853 2552 dbSNP
rs767408346 2558 dbSNP
rs62416345 2561 dbSNP
rs1273505822 2562 dbSNP
rs565907307 2568 dbSNP
rs1332411430 2575 dbSNP
rs1381928830 2576 dbSNP
rs34837595 2577 dbSNP
rs183410841 2578 dbSNP
rs527281676 2581 dbSNP
rs190910294 2589 dbSNP
rs1385836904 2599 dbSNP
rs1406558180 2607 dbSNP
rs957153263 2617 dbSNP
rs1322441022 2620 dbSNP
rs1029050788 2632 dbSNP
rs951604732 2639 dbSNP
rs1394334008 2646 dbSNP
rs549179145 2648 dbSNP
rs998272360 2652 dbSNP
rs965936979 2653 dbSNP
rs1237584558 2658 dbSNP
rs111325639 2664 dbSNP
rs1018425560 2669 dbSNP
rs1004716215 2674 dbSNP
rs886233565 2675 dbSNP
rs1048893737 2676 dbSNP
rs999969868 2678 dbSNP
rs1199507225 2681 dbSNP
rs995966914 2686 dbSNP
rs772909428 2689 dbSNP
rs898599002 2695 dbSNP
rs185363377 2699 dbSNP
rs75913246 2702 dbSNP
rs1009913146 2703 dbSNP
rs937372713 2709 dbSNP
rs3734196 2730 dbSNP
rs547136058 2735 dbSNP
rs538004712 2739 dbSNP
rs1332924910 2742 dbSNP
rs1399107707 2746 dbSNP
rs1463580687 2758 dbSNP
rs1389992385 2760 dbSNP
rs1328779318 2761 dbSNP
rs1341534486 2762 dbSNP
rs1247610770 2763 dbSNP
rs1250021390 2766 dbSNP
rs1334218643 2774 dbSNP
rs1219532391 2776 dbSNP
rs200742310 2783 dbSNP
rs1442404552 2788 dbSNP
rs1194953784 2792 dbSNP
rs1256574202 2796 dbSNP
rs1444127566 2801 dbSNP
rs1185669989 2803 dbSNP
rs927177764 2804 dbSNP
rs1477833262 2805 dbSNP
rs1277139570 2816 dbSNP
rs747802678 2817 dbSNP
rs1045538825 2829 dbSNP
rs1460800274 2830 dbSNP
rs1346192168 2831 dbSNP
rs990350896 2834 dbSNP
rs567757125 2835 dbSNP
rs550148003 2836 dbSNP
rs1311571941 2843 dbSNP
rs1354931229 2854 dbSNP
rs555968422 2855 dbSNP
rs1227280679 2858 dbSNP
rs921729666 2872 dbSNP
rs1306038514 2876 dbSNP
rs1368538572 2887 dbSNP
rs1226956859 2905 dbSNP
rs768347778 2909 dbSNP
rs748821589 2910 dbSNP
rs3734197 2911 dbSNP
rs1358439644 2917 dbSNP
rs1018624623 2918 dbSNP
rs112052123 2929 dbSNP
rs922856915 2930 dbSNP
rs1195140777 2935 dbSNP
rs1259043022 2938 dbSNP
rs1415909483 2938 dbSNP
rs541493804 2952 dbSNP
rs1402705427 2957 dbSNP
rs778052030 2963 dbSNP
rs1436922621 2968 dbSNP
rs1172354870 2974 dbSNP
rs994705107 2993 dbSNP
rs1018417976 2995 dbSNP
rs1168161926 2998 dbSNP
rs1420822660 2999 dbSNP
rs1290775141 3000 dbSNP
rs1447959880 3019 dbSNP
rs180798175 3021 dbSNP
rs898562337 3023 dbSNP
rs1381912415 3028 dbSNP
rs532163382 3028 dbSNP
rs1302182945 3033 dbSNP
rs1000782658 3065 dbSNP
rs1034473479 3077 dbSNP
rs138401761 3091 dbSNP
rs140127858 3091 dbSNP
rs1392082554 3093 dbSNP
rs78185191 3095 dbSNP
rs3734198 3097 dbSNP
rs752933130 3099 dbSNP
rs1485248466 3101 dbSNP
rs1190254190 3110 dbSNP
rs1268978341 3113 dbSNP
rs1443334432 3116 dbSNP
rs1274423224 3129 dbSNP
rs1192212319 3136 dbSNP
rs1394850594 3138 dbSNP
rs1440886630 3143 dbSNP
rs1161884313 3161 dbSNP
rs1343529479 3167 dbSNP
rs946275751 3168 dbSNP
rs765504738 3174 dbSNP
rs1001483485 3180 dbSNP
rs1438967289 3183 dbSNP
rs905793706 3191 dbSNP
rs1467996552 3192 dbSNP
rs1377323908 3194 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 2570.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgagGUCAGAGCUGCAAGGGCCCc 5'
              ||  ||| :|  ||||||| 
Target 5' accaCAACCUCUGC-CUCCCGGGu 3'
 		4 - 26
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgagGUCAGAGCUGCAAGGGCCCc 5'
              ||  ||| :|  ||||||| 
Target 5' accaCAACCUCUGC-CUCCCGGGu 3'
 		4 - 26
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10 PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10 PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000402938.3 | 3UTR | CUCACCACAACCUCUGCCUCCCGGGUUCAAGCAAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000402938.3 | 3UTR | CUCACCACAACCUCUGCCUCCCGGGUUCAAGCAAUUCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
228 hsa-miR-1247-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT107246 PTGES2 prostaglandin E synthase 2 2 2
MIRT118004 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 6
MIRT345983 BIRC5 baculoviral IAP repeat containing 5 2 4
MIRT369967 ZNF264 zinc finger protein 264 2 2
MIRT451350 ZNF573 zinc finger protein 573 2 4
MIRT451367 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT451450 ZNF556 zinc finger protein 556 2 4
MIRT451766 ZNF611 zinc finger protein 611 2 6
MIRT452065 ZNF585B zinc finger protein 585B 2 8
MIRT452346 TG thyroglobulin 2 2
MIRT452519 TFDP2 transcription factor Dp-2 2 6
MIRT452631 FAM162A family with sequence similarity 162 member A 2 2
MIRT452896 PSD4 pleckstrin and Sec7 domain containing 4 2 4
MIRT453263 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT453567 RDH13 retinol dehydrogenase 13 2 2
MIRT453911 GABRR2 gamma-aminobutyric acid type A receptor rho2 subunit 2 4
MIRT454576 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT454859 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455094 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 2
MIRT455790 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT455932 HECTD3 HECT domain E3 ubiquitin protein ligase 3 2 2
MIRT456213 LIX1L limb and CNS expressed 1 like 2 4
MIRT456238 LHPP phospholysine phosphohistidine inorganic pyrophosphate phosphatase 2 6
MIRT456279 HRNR hornerin 2 2
MIRT456665 TIFA TRAF interacting protein with forkhead associated domain 2 2
MIRT457088 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT457322 DUSP19 dual specificity phosphatase 19 2 2
MIRT457695 ZNF587 zinc finger protein 587 2 4
MIRT458160 LYRM4 LYR motif containing 4 2 6
MIRT458465 SNX22 sorting nexin 22 2 8
MIRT458504 MARVELD2 MARVEL domain containing 2 2 2
MIRT458514 GSG2 histone H3 associated protein kinase 2 10
MIRT458645 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT458823 ZNF843 zinc finger protein 843 2 4
MIRT459156 NARF nuclear prelamin A recognition factor 2 2
MIRT459182 HSPA6 heat shock protein family A (Hsp70) member 6 2 4
MIRT459374 MPLKIP M-phase specific PLK1 interacting protein 2 6
MIRT459552 BTD biotinidase 2 2
MIRT459756 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT459860 SVOP SV2 related protein 2 8
MIRT460020 DTX3L deltex E3 ubiquitin ligase 3L 2 6
MIRT460233 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT460275 SLC26A2 solute carrier family 26 member 2 2 2
MIRT460461 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460540 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT460551 IFNAR1 interferon alpha and beta receptor subunit 1 2 6
MIRT460978 STK17B serine/threonine kinase 17b 2 2
MIRT461421 CTSL2 cathepsin V 1 2
MIRT461960 C3 complement C3 2 4
MIRT462529 DHODH dihydroorotate dehydrogenase (quinone) 2 6
MIRT462864 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT462917 ZNRF3 zinc and ring finger 3 2 2
MIRT463022 ZNF70 zinc finger protein 70 2 2
MIRT463074 ZNF639 zinc finger protein 639 2 2
MIRT463130 ZNF451 zinc finger protein 451 2 4
MIRT463627 YY1 YY1 transcription factor 2 2
MIRT467015 SSBP2 single stranded DNA binding protein 2 2 2
MIRT467127 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT468526 SERTAD2 SERTA domain containing 2 2 4
MIRT468584 SERBP1 SERPINE1 mRNA binding protein 1 2 6
MIRT469540 RBBP8 RB binding protein 8, endonuclease 2 2
MIRT469876 PURB purine rich element binding protein B 2 4
MIRT471577 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT472110 NME2 NME/NM23 nucleoside diphosphate kinase 2 2 2
MIRT472127 NME1-NME2 NME1-NME2 readthrough 2 2
MIRT472423 NCKAP1 NCK associated protein 1 2 2
MIRT472829 MTMR10 myotubularin related protein 10 2 4
MIRT473022 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT473408 MDM4 MDM4, p53 regulator 2 2
MIRT474122 LIPC lipase C, hepatic type 2 2
MIRT474927 KCTD20 potassium channel tetramerization domain containing 20 2 2
MIRT476807 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT478006 DNAL1 dynein axonemal light chain 1 2 2
MIRT479200 CLCN5 chloride voltage-gated channel 5 2 6
MIRT479671 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT479917 CCDC117 coiled-coil domain containing 117 2 6
MIRT479977 CARD10 caspase recruitment domain family member 10 2 2
MIRT480731 BPTF bromodomain PHD finger transcription factor 2 6
MIRT481100 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT481160 AVL9 AVL9 cell migration associated 2 6
MIRT481393 ATG12 autophagy related 12 2 2
MIRT481433 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT482083 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT484667 HOXD3 homeobox D3 2 4
MIRT485940 ECSIT ECSIT signalling integrator 2 4
MIRT485950 BRSK1 BR serine/threonine kinase 1 2 2
MIRT487600 NKD2 naked cuticle homolog 2 2 4
MIRT487666 HPCAL1 hippocalcin like 1 2 4
MIRT489966 GNB2 G protein subunit beta 2 2 2
MIRT490332 ANK1 ankyrin 1 2 4
MIRT491314 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 2 2
MIRT493193 MINK1 misshapen like kinase 1 2 4
MIRT493300 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT493816 FSCN1 fascin actin-bundling protein 1 2 2
MIRT496977 RPS6KA2 ribosomal protein S6 kinase A2 2 2
MIRT512229 ATXN3 ataxin 3 2 6
MIRT515141 ZNF799 zinc finger protein 799 2 4
MIRT516647 SMC5 structural maintenance of chromosomes 5 2 2
MIRT517952 TRIM59 tripartite motif containing 59 2 2
MIRT520971 SPPL2A signal peptide peptidase like 2A 2 4
MIRT521569 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT522918 KCNE3 potassium voltage-gated channel subfamily E regulatory subunit 3 2 2
MIRT532713 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT540809 SLC35F5 solute carrier family 35 member F5 2 2
MIRT550734 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT551293 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 4
MIRT559740 ACOX1 acyl-CoA oxidase 1 2 2
MIRT564410 EMILIN2 elastin microfibril interfacer 2 2 2
MIRT565240 TRAF6 TNF receptor associated factor 6 2 2
MIRT568911 ATP6V1B1 ATPase H+ transporting V1 subunit B1 2 2
MIRT575232 Fut1 fucosyltransferase 1 2 2
MIRT576224 Srsf1 serine/arginine-rich splicing factor 1 2 2
MIRT607724 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT608090 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT613920 POU3F1 POU class 3 homeobox 1 2 2
MIRT618520 SELPLG selectin P ligand 2 2
MIRT624703 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT624770 AKR1D1 aldo-keto reductase family 1 member D1 2 2
MIRT625720 SPI1 Spi-1 proto-oncogene 2 2
MIRT629975 MRPL36 mitochondrial ribosomal protein L36 2 2
MIRT631356 ZFP82 ZFP82 zinc finger protein 2 2
MIRT631426 CDNF cerebral dopamine neurotrophic factor 2 2
MIRT631665 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT631735 SF3B1 splicing factor 3b subunit 1 2 2
MIRT632334 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT632419 SLC30A5 solute carrier family 30 member 5 2 2
MIRT632531 PSMB2 proteasome subunit beta 2 2 2
MIRT633264 LDLR low density lipoprotein receptor 2 2
MIRT634327 SLC43A2 solute carrier family 43 member 2 2 2
MIRT634753 CRCP CGRP receptor component 2 2
MIRT635412 KIAA1614 KIAA1614 2 2
MIRT636281 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT636291 RAD51L3-RFFL RAD51L3-RFFL readthrough 2 2
MIRT640265 FANCA Fanconi anemia complementation group A 2 2
MIRT641738 TXNL1 thioredoxin like 1 2 2
MIRT643276 ZNF566 zinc finger protein 566 2 2
MIRT643528 ERAP2 endoplasmic reticulum aminopeptidase 2 2 2
MIRT643555 C11orf70 chromosome 11 open reading frame 70 2 2
MIRT647027 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT647298 RBM43 RNA binding motif protein 43 2 2
MIRT648124 SEMA3E semaphorin 3E 2 4
MIRT648611 TPCN2 two pore segment channel 2 2 2
MIRT648717 IL10RB interleukin 10 receptor subunit beta 2 2
MIRT649425 CDC14B cell division cycle 14B 2 2
MIRT650029 DSG3 desmoglein 3 2 2
MIRT650281 TAS2R5 taste 2 receptor member 5 2 2
MIRT650529 CCDC77 coiled-coil domain containing 77 2 2
MIRT654240 RNF115 ring finger protein 115 2 2
MIRT657032 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT658408 FAM212B family with sequence similarity 212 member B 2 2
MIRT659442 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT661080 FFAR2 free fatty acid receptor 2 2 2
MIRT661529 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT661876 PDLIM5 PDZ and LIM domain 5 2 2
MIRT662100 ZNF419 zinc finger protein 419 2 2
MIRT662136 ZC3H8 zinc finger CCCH-type containing 8 2 2
MIRT663638 HM13 histocompatibility minor 13 2 2
MIRT663703 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663847 TRIM72 tripartite motif containing 72 2 2
MIRT664769 MESDC2 mesoderm development LRP chaperone 2 2
MIRT665481 VSTM4 V-set and transmembrane domain containing 4 2 2
MIRT666533 RNF157 ring finger protein 157 2 2
MIRT668107 GK5 glycerol kinase 5 (putative) 2 2
MIRT668984 CKAP4 cytoskeleton associated protein 4 2 4
MIRT669742 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT671010 MOB4 MOB family member 4, phocein 2 2
MIRT671583 SPIRE2 spire type actin nucleation factor 2 2 2
MIRT673261 INO80 INO80 complex subunit 2 2
MIRT673533 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT674714 FAM73A mitoguardin 1 2 2
MIRT675205 ZNF554 zinc finger protein 554 2 2
MIRT676488 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT676705 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT676851 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT676855 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT676915 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT677000 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT677188 PDE12 phosphodiesterase 12 2 2
MIRT677473 SLC7A11 solute carrier family 7 member 11 2 2
MIRT677562 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677779 FKTN fukutin 2 2
MIRT677896 DCP1A decapping mRNA 1A 2 2
MIRT677996 GATC glutamyl-tRNA amidotransferase subunit C 2 2
MIRT678239 HMGB1 high mobility group box 1 2 4
MIRT678313 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT678437 PDE4C phosphodiesterase 4C 2 2
MIRT678480 RNF222 ring finger protein 222 2 2
MIRT678591 ZNF91 zinc finger protein 91 2 2
MIRT678863 SLC7A14 solute carrier family 7 member 14 2 2
MIRT679241 LRP10 LDL receptor related protein 10 2 2
MIRT679388 WDR92 WD repeat domain 92 2 2
MIRT679501 ZNF106 zinc finger protein 106 2 2
MIRT679581 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT679827 TMEM106B transmembrane protein 106B 2 2
MIRT679842 GPR75 G protein-coupled receptor 75 2 2
MIRT679860 ZFP30 ZFP30 zinc finger protein 2 2
MIRT680733 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT680922 STX2 syntaxin 2 2 2
MIRT680953 CEP104 centrosomal protein 104 2 2
MIRT681053 ZDBF2 zinc finger DBF-type containing 2 2 2
MIRT681967 TFCP2 transcription factor CP2 2 2
MIRT682010 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 2
MIRT682061 B4GALT7 beta-1,4-galactosyltransferase 7 2 4
MIRT682070 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT683356 SCARF1 scavenger receptor class F member 1 2 2
MIRT683699 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT684268 PRPF4 pre-mRNA processing factor 4 2 2
MIRT685500 MED16 mediator complex subunit 16 2 2
MIRT686876 SLC25A32 solute carrier family 25 member 32 2 2
MIRT690869 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT691139 HJURP Holliday junction recognition protein 2 2
MIRT691195 NIF3L1 NGG1 interacting factor 3 like 1 2 2
MIRT691780 SLC24A4 solute carrier family 24 member 4 2 2
MIRT692901 MPL MPL proto-oncogene, thrombopoietin receptor 2 2
MIRT694551 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 2 2
MIRT695421 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT695956 FANCM Fanconi anemia complementation group M 2 2
MIRT696615 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT700682 PPAP2B phospholipid phosphatase 3 2 2
MIRT701215 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT702196 LRRC58 leucine rich repeat containing 58 2 2
MIRT702837 HOOK3 hook microtubule tethering protein 3 2 2
MIRT703652 FAM60A SIN3-HDAC complex associated factor 2 2
MIRT705679 ANKRD40 ankyrin repeat domain 40 2 2
MIRT706650 SMIM19 small integral membrane protein 19 2 2
MIRT711087 NEUROD2 neuronal differentiation 2 2 2
MIRT724961 PTK6 protein tyrosine kinase 6 2 2
MIRT735597 BCL6 B-cell CLL/lymphoma 6 1 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1247 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-1247 Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-mir-1247 Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma tissue
hsa-mir-1247 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-1247 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-1247 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-1247 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-1247 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-1247 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-1247 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1247-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-1247-3p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-1247-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-1247-3p Yuanhuadine 6440572 resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-1247-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-1247-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-1247-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-1247-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-1247-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1247-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1247-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1247-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-1247-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-1247-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-1247-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission