>COMMD5|NM_001081003|3'UTR
   1 CCCCTCACTTGACCAGTCCCATTCAGATCCGGCTTGGACAGGCACCTGAGATGGTGCCAAAGTGCAGCTGACTCTTCCCA
  81 CGACAGCCCTGCCCTTCCCATGAGGCAGGCTCTTCAGTGAGTGTTTGAACGTAATTATGTAGTTTTCTGTTTAATTGAAA
 161 AAGAGAGCTATGCCTTTTTTTCTTTTTGGAAGTAAAGCAGCTAAAAACATGTTTCTATAGGTGAGTGTTGGACCTCACAC
 241 CCTCCCCTTCCCTGTACATTTGTCTTTGGTGCTGGACGTGGCCATGTGAGGCCAGGTTGAGGCCCTTTGTAGACAACATA
 321 CAGTTGCTCAGCCTGGCCCCATGTAGCCAGGTGCTTTTGTAGATCTTGTGTTTTAGGTTGGGCATTTTCACTCTTCTGCC
 401 TTAAATCCCTGACCCCATGGAGCTGACATTCTAGTGCGGCTGAGGGGAGGGGAAACATTGTAAAATAAATCATAAAAATT
 481 AACTGGAATAGCTCATCAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgGGAGGGGACUGAGGGACu 5' ||||||| :|||||| Target 5' acCCTCCCC---TTCCCTGt 3'	239 - 255	147.00	-30.10
2	miRNA 3' cgGGAGGGGACUGAGGGACu 5' :|| ||:| | |||||| Target 5' ctTCTGCCTTAAATCCCTGa 3'	393 - 412	134.00	-19.90
3	miRNA 3' cgGGAGGGGACUGAGGG-ACu 5' ||| ||| :|||| || Target 5' gcCCTGCCC---TTCCCATGa 3'	86 - 103	107.00	-23.60

Mutant ID	Mutant Position	Mutant Source
COSN30169471	6	COSMIC
COSN31522687	12	COSMIC
COSN30149251	48	COSMIC
COSN30110483	124	COSMIC
COSN30110489	125	COSMIC
COSN30125982	130	COSMIC
COSN30128722	166	COSMIC
COSN30511852	168	COSMIC
COSN22822705	209	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1483675440	2	dbSNP
rs771115369	3	dbSNP
rs1009579696	5	dbSNP
rs747127036	8	dbSNP
rs1483955220	10	dbSNP
rs778991192	12	dbSNP
rs755024340	13	dbSNP
rs1397528868	14	dbSNP
rs1314258843	15	dbSNP
rs896543892	18	dbSNP
rs1243670922	24	dbSNP
rs749251157	25	dbSNP
rs371328479	30	dbSNP
rs749992308	31	dbSNP
rs1217831055	32	dbSNP
rs1337322386	33	dbSNP
rs780944429	40	dbSNP
rs369190916	42	dbSNP
rs1285860359	45	dbSNP
rs751132482	50	dbSNP
rs943115773	53	dbSNP
rs1183665759	62	dbSNP
rs1423443212	63	dbSNP
rs888979181	64	dbSNP
rs1185740122	65	dbSNP
rs1382432303	68	dbSNP
rs1051530251	71	dbSNP
rs933260291	81	dbSNP
rs924515544	82	dbSNP
rs905351504	84	dbSNP
rs1458059272	85	dbSNP
rs977825766	91	dbSNP
rs28688029	93	dbSNP
rs1163036114	95	dbSNP
rs533541061	101	dbSNP
rs1414632047	108	dbSNP
rs1241244258	109	dbSNP
rs1185943723	115	dbSNP
rs1309072732	115	dbSNP
rs1212920458	118	dbSNP
rs991599213	122	dbSNP
rs1240238859	124	dbSNP
rs1190314738	125	dbSNP
rs1047354507	126	dbSNP
rs958759129	130	dbSNP
rs570025286	131	dbSNP
rs1272220237	138	dbSNP
rs1211435599	143	dbSNP
rs1323082627	155	dbSNP
rs1289991560	157	dbSNP
rs1178091177	159	dbSNP
rs981579110	163	dbSNP
rs1213426536	168	dbSNP
rs1378152440	168	dbSNP
rs11556545	175	dbSNP
rs1334126864	177	dbSNP
rs922966209	181	dbSNP
rs1272403065	182	dbSNP
rs1436351610	183	dbSNP
rs111584086	184	dbSNP
rs975793563	187	dbSNP
rs1370709393	189	dbSNP
rs1324225061	190	dbSNP
rs951726931	191	dbSNP
rs1463223694	193	dbSNP
rs910385063	198	dbSNP
rs1025857774	199	dbSNP
rs1231079722	207	dbSNP
rs1209881	217	dbSNP
rs967959005	224	dbSNP
rs898866729	226	dbSNP
rs1016332260	228	dbSNP
rs1236612307	233	dbSNP
rs1009548512	245	dbSNP
rs192225163	249	dbSNP
rs138063774	257	dbSNP
rs1417351950	258	dbSNP
rs909276	264	dbSNP
rs888843537	277	dbSNP
rs1051551959	278	dbSNP
rs1288182122	280	dbSNP
rs541405341	293	dbSNP
rs750157726	298	dbSNP
rs1425209752	301	dbSNP
rs903010895	304	dbSNP
rs146237463	309	dbSNP
rs1352424442	317	dbSNP
rs947277951	322	dbSNP
rs1002290013	324	dbSNP
rs905276825	326	dbSNP
rs1280151303	331	dbSNP
rs1403703068	331	dbSNP
rs1318647298	334	dbSNP
rs1038501055	353	dbSNP
rs1209883	362	dbSNP
rs534840546	365	dbSNP
rs1047287472	368	dbSNP
rs1247126910	372	dbSNP
rs1203260793	378	dbSNP
rs914601050	379	dbSNP
rs1277476251	384	dbSNP
rs1477834206	397	dbSNP
rs934275637	398	dbSNP
rs922933693	405	dbSNP
rs1040058269	408	dbSNP
rs563748301	416	dbSNP
rs943094766	417	dbSNP
rs1055780602	418	dbSNP
rs1301727640	419	dbSNP
rs1423259503	419	dbSNP
rs3887745	425	dbSNP
rs937422125	436	dbSNP
rs1341692847	437	dbSNP
rs928669474	438	dbSNP
rs981610326	440	dbSNP
rs968304862	442	dbSNP
rs913765350	448	dbSNP
rs545345444	458	dbSNP
rs988048881	461	dbSNP
rs951618712	463	dbSNP
rs918743481	465	dbSNP
rs974380921	474	dbSNP
rs1034978335	484	dbSNP
rs1488579846	489	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.