miRTarBase - #MIRT454427


—
pre-miRNA Information
pre-miRNA hsa-mir-3689d-1   
Genomic Coordinates chr9: 134849609 - 134849682
Description Homo sapiens miR-3689d-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3689d-2   
Genomic Coordinates chr9: 134850277 - 134850356
Description Homo sapiens miR-3689d-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3689d
Sequence 2| GGGAGGUGUGAUCUCACACUCG |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs551722268 8 dbSNP
rs143142996 8 dbSNP
rs1236297052 12 dbSNP
rs573148947 14 dbSNP
rs1210004979 14 dbSNP
rs1217460444 14 dbSNP
rs762590109 18 dbSNP
rs574332265 18 dbSNP
rs1164353021 21 dbSNP
rs963741171 21 dbSNP
rs1177416877 22 dbSNP
rs765777344 22 dbSNP
Putative Targets

Gene Information
Gene Symbol GTF2F1   
Synonyms BTF4, RAP74, TF2F1, TFIIF
Description general transcription factor IIF subunit 1
Transcript NM_002096   
Expression
Putative miRNA Targets on GTF2F1
3'UTR of GTF2F1
(miRNA target sites are highlighted)		 
>GTF2F1|NM_002096|3'UTR
   1 GGCTTGGTCCAATACATGGCTCTGCCCCCCAGAACTTAAGGCTCTCACTGCCCCTTCGCCATCCTAGAGTGAGGCTCTGT
  81 CCAATACATGGCTCTGCCCTCCAGAACTTCAGGCTCTCAGTGACCCTTCGACATCCTGCTTGCTCCCTGACTCCCAGGGC
 161 CCCGTAGTTAGCAATTCTGGAAAAGTTAAGCCATCTCCTCCTCTGGCCCTTCCTTCTGGAATCTTCAGATGCCTGTTAGG
 241 CCTTCTTATTGTCCTCCTCCTCCTGGCTCGGCCTCCCTCACACTGACCAAGGGCCTGTGCTGCCCACTGGGTAACTTCTA
 321 CAGTTCTCCCTTCCACTTCCCTAAGTCTCTCTTCAGCTGTGACTTATCCACCACATAGCCCAGTAAGTCTTCAGTTTTGG
 401 CTGGGCATGATGGTGAGCGCCTGCAGTCCCAGCTACTTGGGAGGCTAAGCCCAGTTCAAGGCTGCAGTGAACTATGATGG
 481 TGCCACTGCATTCCAGCCTGGGTGACAGAATGAAATCCTGGCACAAAAAAAAAAAAAAAGTAGCCAGGCATGGTGGCGGG
 561 AGCCTGTTGTCCCAGCTGTTCCGTAGGCTGAGGCACGAGATTCACTTGAACCTGGGAGGTGGAGGTTGCTGTGAGCTGAC
 641 ACCACGCCACTGCACTCCAGCCTGGGTGACAGTGAGACTCTGTCTCAATAAATAAAAAATAATAATAAATTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcUCACACUCUAGUGUGGAGGg 5'
            ||| | ||  | ||:|||| 
Target 5' aaAGT-TAAG--C-CATCTCCt 3'
 182 - 199 130.00 -10.40
2 
miRNA  3' gcucacacucuAGUGUGGAGGg 5'
                     |: |||:||| 
Target 5' acagttctcccTTCCACTTCCc 3'
 320 - 341 127.00 -13.52
3 
miRNA  3' gcucACACUCUAGUGUGGAGgg 5'
              |||||| | ||||| |  
Target 5' ttgcTGTGAGCTGACACCACgc 3'
 626 - 647 122.00 -16.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30520858 5 COSMIC
COSN30520859 6 COSMIC
COSN30521384 26 COSMIC
COSN28860562 58 COSMIC
COSN31583345 75 COSMIC
COSN31489354 77 COSMIC
COSN31574520 109 COSMIC
COSN18742899 200 COSMIC
COSN31498058 201 COSMIC
COSN30604549 232 COSMIC
COSN16551402 700 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1244545436 4 dbSNP
rs746277546 7 dbSNP
rs1464191361 9 dbSNP
rs1260778514 11 dbSNP
rs1377116464 11 dbSNP
rs774671746 20 dbSNP
rs893872946 25 dbSNP
rs748734190 26 dbSNP
rs749748984 27 dbSNP
rs1378257166 28 dbSNP
rs779379265 29 dbSNP
rs1000029043 30 dbSNP
rs772474765 31 dbSNP
rs778190675 31 dbSNP
rs777359292 34 dbSNP
rs1384689016 38 dbSNP
rs747691288 41 dbSNP
rs367874489 42 dbSNP
rs1276506567 48 dbSNP
rs1241509869 51 dbSNP
rs558616331 57 dbSNP
rs1275257951 58 dbSNP
rs1239819499 59 dbSNP
rs1292920955 61 dbSNP
rs1041444132 68 dbSNP
rs944638809 69 dbSNP
rs985777820 78 dbSNP
rs545144327 81 dbSNP
rs573003291 82 dbSNP
rs911847281 87 dbSNP
rs138224011 88 dbSNP
rs1180446687 96 dbSNP
rs931827214 99 dbSNP
rs763149040 100 dbSNP
rs1438887277 104 dbSNP
rs536272120 106 dbSNP
rs973148648 107 dbSNP
rs962109702 110 dbSNP
rs1432219692 126 dbSNP
rs145666745 129 dbSNP
rs982218409 130 dbSNP
rs970941303 135 dbSNP
rs1388142304 145 dbSNP
rs1020544351 156 dbSNP
rs1448283909 158 dbSNP
rs1161767278 160 dbSNP
rs1023864898 163 dbSNP
rs756400641 171 dbSNP
rs957283186 173 dbSNP
rs1391321791 181 dbSNP
rs1446668082 208 dbSNP
rs554602677 210 dbSNP
rs538036160 211 dbSNP
rs1012469700 212 dbSNP
rs778697251 213 dbSNP
rs569121286 220 dbSNP
rs140532920 221 dbSNP
rs1265026269 226 dbSNP
rs1340180170 231 dbSNP
rs1032930982 233 dbSNP
rs999576252 234 dbSNP
rs1254925439 244 dbSNP
rs905214445 248 dbSNP
rs1451190558 249 dbSNP
rs1046439731 251 dbSNP
rs1014088439 254 dbSNP
rs902638397 257 dbSNP
rs1421771305 259 dbSNP
rs1186425905 265 dbSNP
rs1373244855 265 dbSNP
rs897957524 268 dbSNP
rs12609323 269 dbSNP
rs118174475 270 dbSNP
rs1465620189 271 dbSNP
rs1303868962 273 dbSNP
rs868735943 275 dbSNP
rs1381818242 287 dbSNP
rs1226025928 292 dbSNP
rs1312319118 294 dbSNP
rs1394603453 294 dbSNP
rs1341406116 304 dbSNP
rs755956650 314 dbSNP
rs1317374222 318 dbSNP
rs890361889 320 dbSNP
rs79254090 328 dbSNP
rs931899229 340 dbSNP
rs1482169794 342 dbSNP
rs1199698782 344 dbSNP
rs541702973 345 dbSNP
rs1262140610 348 dbSNP
rs1478631295 349 dbSNP
rs1050681247 351 dbSNP
rs555416363 361 dbSNP
rs1422292386 363 dbSNP
rs755189944 367 dbSNP
rs1177454976 369 dbSNP
rs920393643 371 dbSNP
rs752712721 378 dbSNP
rs931614571 379 dbSNP
rs1464956770 382 dbSNP
rs1302687495 385 dbSNP
rs922936268 399 dbSNP
rs1402157827 403 dbSNP
rs1037942278 407 dbSNP
rs1330551087 409 dbSNP
rs529682957 418 dbSNP
rs369131621 419 dbSNP
rs981782322 430 dbSNP
rs544617203 435 dbSNP
rs1489109784 439 dbSNP
rs1214017194 440 dbSNP
rs970342835 442 dbSNP
rs531004638 445 dbSNP
rs565088861 450 dbSNP
rs1422418646 451 dbSNP
rs990995214 462 dbSNP
rs545205793 463 dbSNP
rs572967373 465 dbSNP
rs1296612974 469 dbSNP
rs1477777226 477 dbSNP
rs553219758 479 dbSNP
rs978701770 483 dbSNP
rs1013619765 500 dbSNP
rs1218580850 506 dbSNP
rs897888464 507 dbSNP
rs1355616102 512 dbSNP
rs1245166344 521 dbSNP
rs1184305575 522 dbSNP
rs1483519488 523 dbSNP
rs1052265612 524 dbSNP
rs1202772945 525 dbSNP
rs1015040652 526 dbSNP
rs1006774139 536 dbSNP
rs1279316858 537 dbSNP
rs1218124326 538 dbSNP
rs1193576012 539 dbSNP
rs11359697 540 dbSNP
rs1157276048 540 dbSNP
rs1239274254 540 dbSNP
rs1406240697 540 dbSNP
rs1442053198 540 dbSNP
rs375976582 540 dbSNP
rs1342314325 541 dbSNP
rs1167098177 542 dbSNP
rs887964929 542 dbSNP
rs1331996319 543 dbSNP
rs1435786808 543 dbSNP
rs1280905352 544 dbSNP
rs1410011405 548 dbSNP
rs1444450145 552 dbSNP
rs1349498150 553 dbSNP
rs934000795 554 dbSNP
rs966808398 556 dbSNP
rs1020143072 557 dbSNP
rs1008334847 558 dbSNP
rs1287235548 560 dbSNP
rs1320620414 580 dbSNP
rs889763094 581 dbSNP
rs7257794 583 dbSNP
rs932229773 583 dbSNP
rs1377789929 587 dbSNP
rs945755347 596 dbSNP
rs1473296501 597 dbSNP
rs573992385 603 dbSNP
rs774469800 606 dbSNP
rs1177473346 607 dbSNP
rs1388767619 612 dbSNP
rs1183838573 618 dbSNP
rs1411849205 619 dbSNP
rs1413953369 620 dbSNP
rs912959427 621 dbSNP
rs766582714 627 dbSNP
rs1423094933 629 dbSNP
rs1464064214 630 dbSNP
rs1160403389 640 dbSNP
rs1359542746 641 dbSNP
rs1130194 645 dbSNP
rs1251385504 646 dbSNP
rs935811756 647 dbSNP
rs1279612671 653 dbSNP
rs1315449878 655 dbSNP
rs927130951 660 dbSNP
rs899110201 662 dbSNP
rs773540815 663 dbSNP
rs1486568560 668 dbSNP
rs971278728 672 dbSNP
rs1443383848 673 dbSNP
rs1212734388 676 dbSNP
rs530325558 677 dbSNP
rs565381172 682 dbSNP
rs1024263483 683 dbSNP
rs992557894 686 dbSNP
rs1476851350 700 dbSNP
rs940543621 700 dbSNP
rs1167288359 703 dbSNP
rs1015401059 709 dbSNP
rs1209397175 709 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gcUCACACUCUAGUGUGGAGGg 5'
            | ||  |  || ||||||: 
Target 5' ucACUGCAACCUC-CACCUCUc 3'
 		2 - 22
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000394456.5 | 3UTR | CUCACUGCAACCUCCACCUCUCAGGUUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
231 hsa-miR-3689d Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059166 TXNIP thioredoxin interacting protein 2 4
MIRT080699 KIAA1468 KIAA1468 2 2
MIRT218770 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT278059 KHNYN KH and NYN domain containing 2 2
MIRT345933 EIF4A1 eukaryotic translation initiation factor 4A1 2 2
MIRT366238 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT449689 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT451149 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451266 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT451375 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451570 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451585 HIRIP3 HIRA interacting protein 3 2 2
MIRT451614 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451763 ZNF611 zinc finger protein 611 2 6
MIRT452383 LY6E lymphocyte antigen 6 family member E 2 4
MIRT452573 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452735 PTGES3L prostaglandin E synthase 3 like 2 6
MIRT452867 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT452975 CABP4 calcium binding protein 4 2 2
MIRT453215 CERS1 ceramide synthase 1 2 2
MIRT453259 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT453449 GLG1 golgi glycoprotein 1 2 2
MIRT453479 PITPNM3 PITPNM family member 3 2 2
MIRT453663 CD207 CD207 molecule 2 6
MIRT453724 RAP1GDS1 Rap1 GTPase-GDP dissociation stimulator 1 2 2
MIRT453760 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT454181 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454330 PPARA peroxisome proliferator activated receptor alpha 2 2
MIRT454338 CDKL1 cyclin dependent kinase like 1 2 2
MIRT454427 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454665 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT454825 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT455130 TBC1D25 TBC1 domain family member 25 2 2
MIRT455166 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455416 RXRB retinoid X receptor beta 2 2
MIRT455668 GLO1 glyoxalase I 2 2
MIRT455999 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456446 TMEM81 transmembrane protein 81 2 2
MIRT456642 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT456728 TMEM239 transmembrane protein 239 2 2
MIRT457131 ASPH aspartate beta-hydroxylase 2 2
MIRT457157 MXRA7 matrix remodeling associated 7 2 2
MIRT457358 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457458 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT457619 UPK3BL uroplakin 3B like 1 2 2
MIRT457692 ZNF587 zinc finger protein 587 2 2
MIRT457727 SMOX spermine oxidase 2 2
MIRT457788 VWA1 von Willebrand factor A domain containing 1 2 2
MIRT457875 THEM6 thioesterase superfamily member 6 2 4
MIRT457909 ZNF212 zinc finger protein 212 2 2
MIRT458395 ABCF1 ATP binding cassette subfamily F member 1 2 2
MIRT458496 MARVELD2 MARVEL domain containing 2 2 2
MIRT458544 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT458577 TCOF1 treacle ribosome biogenesis factor 1 2 2
MIRT458732 CES2 carboxylesterase 2 2 2
MIRT458814 ZNF843 zinc finger protein 843 2 2
MIRT458931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT459341 ZNF17 zinc finger protein 17 2 2
MIRT459365 MPLKIP M-phase specific PLK1 interacting protein 2 6
MIRT459572 NLGN2 neuroligin 2 2 2
MIRT460015 DTX3L deltex E3 ubiquitin ligase 3L 2 4
MIRT460144 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460653 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460798 VPS33A VPS33A, CORVET/HOPS core subunit 2 2
MIRT461058 KCNK6 potassium two pore domain channel subfamily K member 6 2 4
MIRT461458 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461572 SCO1 SCO1, cytochrome c oxidase assembly protein 2 4
MIRT461927 TNFSF14 TNF superfamily member 14 2 2
MIRT461953 C3 complement C3 2 2
MIRT462278 KRR1 KRR1, small subunit processome component homolog 2 2
MIRT462744 EFNB1 ephrin B1 2 2
MIRT463136 ZNF451 zinc finger protein 451 2 4
MIRT463566 ZBTB39 zinc finger and BTB domain containing 39 2 6
MIRT463866 WNT7B Wnt family member 7B 2 2
MIRT464326 UST uronyl 2-sulfotransferase 2 2
MIRT464796 UBE2F ubiquitin conjugating enzyme E2 F (putative) 2 2
MIRT465034 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT466207 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT467007 SSBP2 single stranded DNA binding protein 2 2 2
MIRT467029 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT468001 SKI SKI proto-oncogene 2 2
MIRT468031 SIKE1 suppressor of IKBKE 1 2 6
MIRT468575 SERBP1 SERPINE1 mRNA binding protein 1 2 6
MIRT468834 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT468970 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469450 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470888 PLXND1 plexin D1 2 2
MIRT470953 PKM pyruvate kinase, muscle 2 2
MIRT471828 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT472590 NACC1 nucleus accumbens associated 1 2 2
MIRT472805 MTMR12 myotubularin related protein 12 2 2
MIRT472818 MTMR10 myotubularin related protein 10 2 6
MIRT472914 MSN moesin 2 2
MIRT474558 KLHDC3 kelch domain containing 3 2 2
MIRT474716 KIF13A kinesin family member 13A 2 6
MIRT475279 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475300 IFNLR1 interferon lambda receptor 1 2 2
MIRT475759 HDLBP high density lipoprotein binding protein 2 2
MIRT475786 HDGF heparin binding growth factor 2 2
MIRT475933 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476212 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT476238 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 4
MIRT476799 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT477988 DNAL1 dynein axonemal light chain 1 2 2
MIRT478317 DDN dendrin 2 2
MIRT479257 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT479344 CEP97 centrosomal protein 97 2 2
MIRT479522 CDCA4 cell division cycle associated 4 2 2
MIRT479906 CCDC117 coiled-coil domain containing 117 2 6
MIRT481147 AVL9 AVL9 cell migration associated 2 6
MIRT481735 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482089 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT482389 AEN apoptosis enhancing nuclease 2 2
MIRT483093 TFPI tissue factor pathway inhibitor 2 2
MIRT484246 ANK1 ankyrin 1 2 2
MIRT484342 EPN1 epsin 1 2 4
MIRT489141 C5orf38 chromosome 5 open reading frame 38 2 2
MIRT489163 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489547 SOX11 SRY-box 11 2 4
MIRT489780 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489799 KRT80 keratin 80 2 6
MIRT490535 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT492198 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492283 SHISA6 shisa family member 6 2 4
MIRT501059 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT501094 SLC5A6 solute carrier family 5 member 6 2 4
MIRT503870 CBS cystathionine-beta-synthase 2 2
MIRT507981 BCL2L13 BCL2 like 13 2 4
MIRT508125 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT508205 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508385 SPTBN2 spectrin beta, non-erythrocytic 2 2 4
MIRT510308 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT510462 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT512227 ATXN3 ataxin 3 2 8
MIRT512665 STEAP3 STEAP3 metalloreductase 2 2
MIRT514184 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT515053 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515138 ZNF799 zinc finger protein 799 2 4
MIRT515452 ZNF747 zinc finger protein 747 2 2
MIRT515791 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT515905 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT516129 MRPS16 mitochondrial ribosomal protein S16 2 6
MIRT516679 ZNF860 zinc finger protein 860 2 4
MIRT516750 ZNF100 zinc finger protein 100 2 2
MIRT516971 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT517491 NPAP1 nuclear pore associated protein 1 2 2
MIRT517774 PROM2 prominin 2 2 2
MIRT517938 ZNF431 zinc finger protein 431 2 4
MIRT518386 ZNF250 zinc finger protein 250 2 2
MIRT520621 TMEM41B transmembrane protein 41B 2 2
MIRT521028 SLC30A5 solute carrier family 30 member 5 2 2
MIRT521454 RAD51 RAD51 recombinase 2 2
MIRT521564 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT521581 PTBP2 polypyrimidine tract binding protein 2 2 2
MIRT522263 NKRF NFKB repressing factor 2 2
MIRT522410 MXI1 MAX interactor 1, dimerization protein 2 2
MIRT522543 MED28 mediator complex subunit 28 2 6
MIRT522915 KCNE3 potassium voltage-gated channel subfamily E regulatory subunit 3 2 2
MIRT523029 IGF1 insulin like growth factor 1 2 2
MIRT523854 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT524184 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT524520 CDK19 cyclin dependent kinase 19 2 2
MIRT524674 C12orf5 TP53 induced glycolysis regulatory phosphatase 2 2
MIRT530257 ZNF620 zinc finger protein 620 2 2
MIRT540691 BMP3 bone morphogenetic protein 3 2 2
MIRT540976 C17orf85 nuclear cap binding subunit 3 2 2
MIRT545505 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT545631 GGCX gamma-glutamyl carboxylase 2 2
MIRT547358 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT550701 MPL MPL proto-oncogene, thrombopoietin receptor 2 4
MIRT550717 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT551203 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT553999 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 4
MIRT561081 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT563523 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT564463 SLC35E2 solute carrier family 35 member E2 2 2
MIRT565233 TRAF6 TNF receptor associated factor 6 2 2
MIRT566618 NKAP NFKB activating protein 2 2
MIRT569527 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT569639 QPCT glutaminyl-peptide cyclotransferase 2 2
MIRT570253 SSPN sarcospan 2 2
MIRT570570 OTUD7B OTU deubiquitinase 7B 2 2
MIRT570621 MTF2 metal response element binding transcription factor 2 2 2
MIRT571098 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 2 2
MIRT575196 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575554 Cd99 CD99 antigen 2 2
MIRT575634 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 2
MIRT608267 NOP14 NOP14 nucleolar protein 2 2
MIRT609314 FXYD6 FXYD domain containing ion transport regulator 6 2 2
MIRT627670 RPL28 ribosomal protein L28 2 2
MIRT631185 TSPAN14 tetraspanin 14 2 2
MIRT631964 YIPF5 Yip1 domain family member 5 2 2
MIRT632885 GINM1 glycoprotein integral membrane 1 2 2
MIRT642618 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT645609 TSPAN6 tetraspanin 6 2 2
MIRT662227 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662329 MYLK3 myosin light chain kinase 3 2 2
MIRT662725 LRRC3C leucine rich repeat containing 3C 2 2
MIRT665520 USP14 ubiquitin specific peptidase 14 2 2
MIRT666634 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT668969 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT670925 DESI1 desumoylating isopeptidase 1 2 2
MIRT673939 ZNF500 zinc finger protein 500 2 2
MIRT674675 PLCE1 phospholipase C epsilon 1 2 2
MIRT675230 MAK male germ cell associated kinase 2 2
MIRT680864 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT681047 ZDBF2 zinc finger DBF-type containing 2 2 2
MIRT681105 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT683553 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT684508 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT684812 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT685981 CCDC77 coiled-coil domain containing 77 2 2
MIRT686709 TBC1D19 TBC1 domain family member 19 2 2
MIRT686867 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688908 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT691208 KLHL30 kelch like family member 30 2 2
MIRT692298 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT694380 MTA1 metastasis associated 1 2 2
MIRT696497 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT700686 POLR3D RNA polymerase III subunit D 2 2
MIRT701088 PAPOLG poly(A) polymerase gamma 2 2
MIRT703373 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT706189 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT706648 SMIM19 small integral membrane protein 19 2 2
MIRT709466 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT709699 DMWD DM1 locus, WD repeat containing 2 2
MIRT710693 LYRM4 LYR motif containing 4 2 2
MIRT713457 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 2 2
MIRT722409 RARS2 arginyl-tRNA synthetase 2, mitochondrial 2 2
MIRT725391 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT725548 DNMT3A DNA methyltransferase 3 alpha 2 2

Error report submission