| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-3189 |
| Genomic Coordinates | chr19: 18386562 - 18386634 |
| Description | Homo sapiens miR-3189 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-3189-5p | |||||||||||||||||||||
| Sequence | 9| UGCCCCAUCUGUGCCCUGGGUAGGA |33 | |||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||
| Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | RBM14 | ||||||||||||||||||||
| Synonyms | COAA, PSP2, SIP, SYTIP1, TMEM137 | ||||||||||||||||||||
| Description | RNA binding motif protein 14 | ||||||||||||||||||||
| Transcript | NM_006328 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on RBM14 | |||||||||||||||||||||
| 3'UTR of RBM14 (miRNA target sites are highlighted) |
>RBM14|NM_006328|3'UTR 1 GGCCATCCTGGGATGGGGCACCACAGGGAGGGAGGGAGAAAAGAGGTGGGTAGGGTTACAGATCCAGGTTATAACTACTC 81 TGGCCCATACCTTTCCTGGTTGTGGTTTTTCATGCCCTCTACCATGTGGGCCTTCCCCAGGAGATGATCCTGTTAAGTGT 161 TCGGCAGTAACCTACTTTGTTCCTTCGCCTCAGCAGCAAATCTTGCTACTGGCTCTAGATCTGCGGTTTCCCCTCTACCC 241 TGCCTCCCGTCTCCCCAGAATGGGAATTTCTTTTATGTTTTTATTTTTTTCCTGGCTCCCTTTTATTTTTGTGCGCGATA 321 TTTAAGGTCGTCTGGATGGGGAAGCAACCTGCAGCTGAGGTCGCCGGCGCCTTTTTCTTTTTAGATGGGAAGGAGGCCAG 401 GAAAGGGTCAGCTTAACCATTTCCTATGTGCCAAGCTGTGCCAGCAGTCCAGGGTACCCTGACTGTCCCTCTGTAGACTG 481 TTGAGACTGAGTTCCTGTTGGGACAGTCAGTTGGTATGTATCCAAGTCCCTGCTGACCACTAATGTTCTAGCTGATGGTG 561 AGCGGCACAGTCCCACTTCCCCATCTCCCCAAGTAGGTGGTGTTAGAAAACCTTAATTTTTTTTCCCTTTTGTATGGACT 641 ACAAATAAAACTTGGGGCAATTTGCAGTTTGGAAACCTGGTTGTCATTGTCTTGATTGCATTCAGTGTCAAAGGAGCCAA 721 TTTGACATCCAGGAAGACATGATAGCTAAAGGGAAGGCAGTCAGAGAACCCAGGACTGGTGAGGAAAGGGGTTTGAATGT 801 CGGAATTAGAAGGATTGCCCTGTGGCCCAGAAGGATTTAGCTCATCGTCGTCCTGCTAGCCTGCCATCTTTCAGACTTTC 881 CAGGGCAGGTGGCCTGGTCCTCAGCCCTCAACTTGAGTTAGTCACACCAAAATGCAGTAAATGATGCCCATTTTCCTCTG 961 CCTGTGCTTGACCATTTTCACTGACTTTTCTCCAGTTCAGGAATAACCTGTGTTCCAATGGGATGGTTCTGGGGTTTGGC 1041 CTCTTAGGAAGTGGGGAATGGGCTGCTGTGGTATTTACAGGCTAGTAGATCCTTTAGGCAGTAGGCTGGAATGAGTGCTG 1121 GGGCTGGGACCCAGAAAGGAACCAGTAGTGGAGTGGGGGTAATGGCGTTGCCTGATACTGCCCTATGGTTGGAATAAGGA 1201 AGGGCAGAGAAAACTTGAAGCAGGTATGGGGCATTCTGGCCATAGAGCTCGTATTTTGCCTGTTGAGCTGTACCATGGAG 1281 CATCCTCCTGTGTCCTGCCAACCCCTGCCATTATAGTCACCGGAGACTCCTTTACCTATCCCTATCTGTTAGGGTTTTCA 1361 GATGTCCTCTCGCTGGGTTTATATTTGAAGGTATAGAATCTGGGAAAGGGTGGGGTGCAAGCTAACCAAATAGGGATGCT 1441 AGGGTTGGGTGGGGAATTGAGGACTCTTCTGTGCTTTTATTGTAGGGCTGGGGATCGAGGATCTGGGCAAAAAATATGAC 1521 ATTTCCAACCAGGGACAAAATGGAGGCTTGGGCTTAGTGATGGGTAAATGGAAGACTGGTTGAGTGGGATGATAATGGGA 1601 GAACTTACTGATGCTCTTTTGGGAAAAGGTGCTTTAAAGACTCGATTTGGGAGCCTACTGGGGCAAGGCGACTGGGGAGG 1681 TGTACGTGTTAGTCAAGTGGAGGTCAGGTGGGTTATCTTCTGCCTCCTTCACTGGCTTCATGTGAACTTGCCTGTGACAG 1761 AATATCTTGCCCTAGATGTCCTCTTCCCTCTTGCCATCGTGCAAAAGCATTCGATCTTATGACCGTGAGTTCTTATTTGT 1841 GGATGCTAACTGGGGTAATCTCAGGGAGTACTGGGGCCATGGCTCTTTCCCTTGCTTCTCTTTCTGCTCACTGCTTTGCT 1921 TTCAGGTGCTTAGCTGCTCCTTTTTATTTCTTTGCAGGACTGGGAAAGCATGGGAGGAGGATTTTGATAAGTTTCTTGTT 2001 CTCTGCGTGGTGATGGGGTGGTCTGAGGGCCAAGTTAATAAGCCTACCTTTGGTTATTACCCTGGAAAATTGAGGGTTGA 2081 TGGTAGGGTTATGATTGTGGCCTGTGTATTTGCAATTTTTCTTTGTCAGTGTGGCTTTCTGTCATCTTCCTTTTTCTCCA 2161 GTGAGGGTTCTGCCACTGTCTCAATCCCTTGGTTCCTGCAAAAAACAGCTAAATGTGCTCTCAGGGCCAGTGGTGATGTT 2241 CTGTGTTGCAGCCCCAGCTCTTGAAAGTGACCTGGCCCAGATGAGCTCTGCCTGCTTGTCATCTTTAGGTCCTGCTGCCC 2321 CTGCTGCCTCAGCCCTCAGGCTCCTAACTGCTCAAGCCAGAAGGAGCTACAAAGCCAAATCATTTGTCATTTTTCTCTGG 2401 CAGATTGTTTTAAAATCTCCCTCCCCTCTTTTATTTTAATTATGCCACCTGTGTTAATCCTATAGCCTGCTTCTTTGCTT 2481 TGTGGATTACTGATTTCAAGTTCTATAACTTGGGGAAAGTTAGGTTGAGTGAATGGGAGGACAGACACTGAATGTGTGTT 2561 TTGGAAAAATGGACTCTCTATCTTCAGATTATTCAGCTTCTCCACCTATCACCTCTACAACTTGGCCTTCATTGGAGAAG 2641 TTTTAGTTGGCTTATTCCTGGAACAAGACCACCTAGAGGCTTTTAGCCTTGTCAGCCTGCCCTCTTCTGAGGTTTGGACC 2721 TTGTTTTAAATTGTGTGCATGGTGGGCTTGAGACTCTCTTGTAATGGAGGTAATGGGACTATCACTGAGGGGTTCAGCCT 2801 ATCCAGGTAGGCTACCGTTCTAGTCATACCCATCACTTAAATTCTGCCACAGTCTGCACAGACGGTTGGTCCTCCAGGCA 2881 TATTGTCCTATTAAGCCAAATAGGTGGACATCATGGGATGGATGAGGTCATCATGAAAACAGATTTACTGGATTTATGGA 2961 CCTAGTATATACTATGTAACAGATGGAAAACTGAATTTTACAATCTATAGGTACCTTTGAAAGGTCATAAAGGGTAAAAG 3041 TCTATAGTTTTCCAGAAAATAATTCTTAAAACTGGGTTTTATGTCTAGATTTAAATCATGTATCTGTCTGTAGTGCTTCA 3121 AATGTGGCCAGGTGTGGTAGCTCACACCTGTAATTCCCAGCGCTTTGGGAATTTGAGGCAAGAGGATTGCTAGAGGCCAG 3201 GATTTTGAGACCAGCTTCGGCAATACGGTGAGACCTTGTCTCTACCAAAAGAAAAGAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 10432.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 10432.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| CLIP-seq Support 1 for dataset GSM4903833 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
| Location of target site | NM_006328 | 3UTR | GAGCCUACUGGGGCAAGGCGACUGGGGAGGUGUAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000393979.3 | 3UTR | ACUACAAAUAAAACUUGGGGCAAUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000393979.3 | 3UTR | ACUACAAAUAAAACUUGGGGCAAUUUGCAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000393979.3 | 3UTR | ACUACAAAUAAAACUUGGGGCAAUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000393979.3 | 3UTR | ACUACAAAUAAAACUUGGGGCAAUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000393979.3 | 3UTR | GUAUGGACUACAAAUAAAACUUGGGGCAAUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
54 hsa-miR-3189-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT055405 | SHOC2 | SHOC2, leucine rich repeat scaffold protein |  |
|
2 | 6 | ||||||
| MIRT263576 | GHITM | growth hormone inducible transmembrane protein | |
|
2 | 2 | ||||||
| MIRT338983 | CPSF6 | cleavage and polyadenylation specific factor 6 | |
|
2 | 2 | ||||||
| MIRT404222 | RPL7L1 | ribosomal protein L7 like 1 | |
|
2 | 2 | ||||||
| MIRT451745 | CES3 | carboxylesterase 3 | |
|
2 | 2 | ||||||
| MIRT454466 | RBM14 | RNA binding motif protein 14 | |
|
2 | 8 | ||||||
| MIRT477627 | EFNA1 | ephrin A1 | |
|
2 | 2 | ||||||
| MIRT495128 | METTL24 | methyltransferase like 24 | |
|
2 | 2 | ||||||
| MIRT496506 | G6PC | glucose-6-phosphatase catalytic subunit | |
|
2 | 2 | ||||||
| MIRT497260 | GRK6 | G protein-coupled receptor kinase 6 | |
|
2 | 2 | ||||||
| MIRT501881 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | |
|
2 | 2 | ||||||
| MIRT504586 | ADH1B | alcohol dehydrogenase 1B (class I), beta polypeptide | |
|
2 | 4 | ||||||
| MIRT505570 | SMC1A | structural maintenance of chromosomes 1A | |
|
2 | 6 | ||||||
| MIRT506759 | KMT2D | lysine methyltransferase 2D | |
|
2 | 2 | ||||||
| MIRT512454 | POLR3G | RNA polymerase III subunit G | |
|
2 | 2 | ||||||
| MIRT512716 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | |
|
2 | 2 | ||||||
| MIRT514382 | CLUAP1 | clusterin associated protein 1 | |
|
2 | 2 | ||||||
| MIRT519861 | ZFP62 | ZFP62 zinc finger protein | |
|
2 | 6 | ||||||
| MIRT525670 | NHLRC4 | NHL repeat containing 4 | |
|
2 | 2 | ||||||
| MIRT526359 | TIMMDC1 | translocase of inner mitochondrial membrane domain containing 1 | |
|
2 | 2 | ||||||
| MIRT526656 | PRSS42 | protease, serine 42 | |
|
2 | 4 | ||||||
| MIRT527017 | PABPN1L | poly(A) binding protein nuclear 1 like, cytoplasmic | |
|
2 | 2 | ||||||
| MIRT532190 | MPDU1 | mannose-P-dolichol utilization defect 1 | |
|
2 | 2 | ||||||
| MIRT533223 | VPS4A | vacuolar protein sorting 4 homolog A | |
|
2 | 2 | ||||||
| MIRT543161 | GTF2A1 | general transcription factor IIA subunit 1 | |
|
2 | 2 | ||||||
| MIRT552228 | SART3 | squamous cell carcinoma antigen recognized by T-cells 3 | |
|
2 | 2 | ||||||
| MIRT552719 | YTHDC1 | YTH domain containing 1 | |
|
2 | 2 | ||||||
| MIRT556873 | IVNS1ABP | influenza virus NS1A binding protein | |
|
2 | 2 | ||||||
| MIRT558255 | DYNLL2 | dynein light chain LC8-type 2 | |
|
2 | 2 | ||||||
| MIRT563105 | IFRD2 | interferon related developmental regulator 2 | |
|
2 | 2 | ||||||
| MIRT565436 | SURF4 | surfeit 4 | |
|
2 | 2 | ||||||
| MIRT568459 | ARPP19 | cAMP regulated phosphoprotein 19 | |
|
2 | 2 | ||||||
| MIRT572804 | PPP3CB | protein phosphatase 3 catalytic subunit beta | |
|
2 | 2 | ||||||
| MIRT576203 | Baz2a | bromodomain adjacent to zinc finger domain, 2A | |
|
2 | 2 | ||||||
| MIRT623519 | KCNK10 | potassium two pore domain channel subfamily K member 10 | |
|
2 | 2 | ||||||
| MIRT637006 | HHAT | hedgehog acyltransferase | |
|
2 | 2 | ||||||
| MIRT643668 | WDR5 | WD repeat domain 5 | |
|
2 | 2 | ||||||
| MIRT647472 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | |
|
2 | 2 | ||||||
| MIRT650823 | LZTR1 | leucine zipper like transcription regulator 1 | |
|
2 | 2 | ||||||
| MIRT657377 | HMGA1 | high mobility group AT-hook 1 | |
|
2 | 2 | ||||||
| MIRT685077 | HPSE | heparanase | |
|
2 | 2 | ||||||
| MIRT687565 | MDGA1 | MAM domain containing glycosylphosphatidylinositol anchor 1 | |
|
2 | 2 | ||||||
| MIRT696101 | SETD1A | SET domain containing 1A | |
|
2 | 2 | ||||||
| MIRT704887 | CCND1 | cyclin D1 | |
|
2 | 2 | ||||||
| MIRT709133 | GLG1 | golgi glycoprotein 1 | |
|
2 | 2 | ||||||
| MIRT709189 | SAPCD2 | suppressor APC domain containing 2 | |
|
2 | 2 | ||||||
| MIRT713407 | PEX16 | peroxisomal biogenesis factor 16 | |
|
2 | 2 | ||||||
| MIRT713467 | SLC22A12 | solute carrier family 22 member 12 | |
|
2 | 2 | ||||||
| MIRT714544 | COL14A1 | collagen type XIV alpha 1 chain | |
|
2 | 2 | ||||||
| MIRT716953 | TFAP2B | transcription factor AP-2 beta | |
|
2 | 2 | ||||||
| MIRT717325 | PGK1 | phosphoglycerate kinase 1 | |
|
2 | 2 | ||||||
| MIRT718252 | ZDHHC8 | zinc finger DHHC-type containing 8 | |
|
2 | 2 | ||||||
| MIRT718522 | WDR33 | WD repeat domain 33 | |
|
2 | 2 | ||||||
| MIRT723002 | FADS1 | fatty acid desaturase 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|