>SLC29A1|NM_001078175|3'UTR
   1 CAAAGGATGGACAGAAGGACTGCCTGCCTCCCTCCCTGTCTGCCTCCTGCCCCTTCCTTCTGCCAGGGGTGATCCTGAGT
  81 GGTCTGGCGGTTTTTTCTTCTAACTGACTTCTGCTTTCCACGGCGTGTGCTGGGCCCGGATCTCCAGGCCCTGGGGAGGG
 161 AGCCTCTGGACGGACAGTGGGGACATTGTGGGTTTGGGGCTCAGAGTCGAGGGACGGGGTGTAGCCTCGGCATTTGCTTG
 241 AGTTTCTCCACTCTTGGCTCTGACTGATCCCTGCTTGTGCAGGCCAGTGGAGGCTCTTGGGCTTGGAGAACACGTGTGTC
 321 TCTGTGTATGTGTCTGTGTGTCTGCGTCCGTGTCTGTCAGACTGTCTGCCTGTCCTGGGGTGGCTAGGAGCTGGGTCTGA
 401 CCGTTGTATGGTTTGACCTGATATACTCCATTCTCCCCTGCGCCTCCTCCTCTGTGTTCTCTCCATGTCCCCCTCCCAAC
 481 TCCCCATGCCCAGTTCTTACCCATCATGCACCCTGTACAGTTGCCACGTTACTGCCTTTTTTAAAAATATATTTGACAGA
 561 AACCAGGTGCCTTCAGAGGCTCTCTGATTTAAATAAACCTTTCTTGTTTTTTTCTCCATGGCTAAAAAAAAAAAAAAAAA
 641 A

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aucgucguacuuGGACAGAg 5' ||||||| Target 5' cctgcctccctcCCTGTCTg 3'	23 - 42	140.00	-9.10
2	miRNA 3' aucGUC--GUACUUGGACAGag 5' ||| ::| :|||||| Target 5' tgtCAGACTGTCTGCCTGTCct 3'	355 - 376	127.00	-13.20
3	miRNA 3' aucgucgUACUUGGACAGAg 5' || ||||| ||| Target 5' gatttaaATAAACCTTTCTt 3'	586 - 605	125.00	-6.90

Mutant ID	Mutant Position	Mutant Source
COSN26995159	10	COSMIC
COSN31554361	10	COSMIC
COSN30179152	36	COSMIC
COSN30540732	57	COSMIC
COSN30491717	64	COSMIC
COSN7883678	90	COSMIC
COSN31481170	112	COSMIC
COSN1333542	139	COSMIC
COSN15661808	247	COSMIC
COSN31591725	280	COSMIC
COSN7883679	443	COSMIC
COSN5630511	464	COSMIC
COSN31541407	532	COSMIC
COSN24945292	563	COSMIC
COSN19023843	568	COSMIC
COSN30176185	575	COSMIC
COSN31533513	614	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs755595105	7	dbSNP
rs779358682	8	dbSNP
rs753237989	9	dbSNP
rs1218589894	18	dbSNP
rs750692095	20	dbSNP
rs756185570	23	dbSNP
rs1214141199	24	dbSNP
rs1340384856	24	dbSNP
rs1021651946	27	dbSNP
rs1261363373	29	dbSNP
rs1488079409	32	dbSNP
rs1194566528	33	dbSNP
rs758770756	34	dbSNP
rs1366388988	36	dbSNP
rs1366772742	37	dbSNP
rs1477050319	39	dbSNP
rs8187637	47	dbSNP
rs201301264	48	dbSNP
rs1370606709	50	dbSNP
rs771297314	51	dbSNP
rs369843834	52	dbSNP
rs745985327	53	dbSNP
rs1396526514	54	dbSNP
rs1209561391	57	dbSNP
rs1434146421	65	dbSNP
rs960203143	69	dbSNP
rs1189958610	70	dbSNP
rs1010497330	83	dbSNP
rs1252620158	85	dbSNP
rs528317649	87	dbSNP
rs1022005087	89	dbSNP
rs993042991	90	dbSNP
rs1233642684	91	dbSNP
rs980923239	91	dbSNP
rs927848582	99	dbSNP
rs1225390663	100	dbSNP
rs1257366796	111	dbSNP
rs546769025	122	dbSNP
rs1180332719	123	dbSNP
rs769046429	125	dbSNP
rs930632954	126	dbSNP
rs949020089	134	dbSNP
rs571306317	138	dbSNP
rs984177713	139	dbSNP
rs1173104289	146	dbSNP
rs909566926	154	dbSNP
rs1393427567	156	dbSNP
rs1181499885	167	dbSNP
rs532283884	172	dbSNP
rs1259761178	173	dbSNP
rs1483086991	179	dbSNP
rs910546260	179	dbSNP
rs1303190182	180	dbSNP
rs1217696800	197	dbSNP
rs1395559159	203	dbSNP
rs1287678047	209	dbSNP
rs1329708322	209	dbSNP
rs866512035	210	dbSNP
rs900982685	216	dbSNP
rs902025879	217	dbSNP
rs1327035706	222	dbSNP
rs933810890	227	dbSNP
rs999397746	228	dbSNP
rs550425829	229	dbSNP
rs889683446	230	dbSNP
rs1389956599	232	dbSNP
rs1159048087	238	dbSNP
rs1349577762	254	dbSNP
rs1370268543	256	dbSNP
rs1010835510	258	dbSNP
rs1256920817	261	dbSNP
rs1021610992	265	dbSNP
rs568929212	271	dbSNP
rs1188009428	275	dbSNP
rs904526527	278	dbSNP
rs1267314973	288	dbSNP
rs1206705672	291	dbSNP
rs1336938542	297	dbSNP
rs998906302	300	dbSNP
rs1031751074	313	dbSNP
rs960188769	315	dbSNP
rs543538594	317	dbSNP
rs1338266867	319	dbSNP
rs557132527	323	dbSNP
rs1435424087	327	dbSNP
rs528640310	329	dbSNP
rs1251274410	335	dbSNP
rs536221050	346	dbSNP
rs970688365	347	dbSNP
rs1177010699	350	dbSNP
rs1372744953	351	dbSNP
rs1460227968	355	dbSNP
rs960578377	359	dbSNP
rs1172565063	363	dbSNP
rs984410265	364	dbSNP
rs909514759	378	dbSNP
rs554798146	387	dbSNP
rs939699769	388	dbSNP
rs1267978941	403	dbSNP
rs1208687139	404	dbSNP
rs781038578	407	dbSNP
rs972407048	408	dbSNP
rs1228674101	411	dbSNP
rs1341088899	420	dbSNP
rs1297247723	424	dbSNP
rs984691424	425	dbSNP
rs1333290505	437	dbSNP
rs145776583	438	dbSNP
rs78098903	442	dbSNP
rs14623	443	dbSNP
rs976204345	445	dbSNP
rs576891489	446	dbSNP
rs1430632309	447	dbSNP
rs112703920	448	dbSNP
rs1166411051	451	dbSNP
rs1294344879	457	dbSNP
rs1478904795	460	dbSNP
rs3734703	470	dbSNP
rs1198043814	473	dbSNP
rs1225612689	476	dbSNP
rs1253325802	478	dbSNP
rs1205267992	481	dbSNP
rs1046309	497	dbSNP
rs1482484172	504	dbSNP
rs1272076922	509	dbSNP
rs1226579963	513	dbSNP
rs946585960	521	dbSNP
rs1043671838	526	dbSNP
rs544943554	529	dbSNP
rs1260467320	536	dbSNP
rs72548775	543	dbSNP
rs1213665497	556	dbSNP
rs1410522231	558	dbSNP
rs1370144276	566	dbSNP
rs1306427604	578	dbSNP
rs1416419294	586	dbSNP
rs1402636311	587	dbSNP
rs1171842261	590	dbSNP
rs947669985	595	dbSNP
rs1414093011	600	dbSNP
rs1182217909	604	dbSNP
rs745899359	607	dbSNP
rs1249042998	609	dbSNP
rs1211766025	615	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.