>RPL13A|NM_012423|3'UTR
   1 GCCCAATAAAGACTGTTAATTCCTCATGCGTTGCCTGCCCTTCCTCCATTGTTGCCCTGGAATGTACGGGACCCAGGGGC
  81 AGCAGCAGTCCAGGTGCCACAGGCAGCCCTGGGACATAGGAAGCTGGGAGCAAGGAAAGGGTCTTAGTCACTGCCTCCCG
 161 AAGTTGCTTGAAAGCACTCGGAGAATTGTGCAGGTGTCATTTATCTATGACCAATAGGAAGAGCAACCAGTTACTATGAG
 241 TGAAAGGGAGCCAGAAGACTGATTGGAGGGCCCTATCTTGTGAGTGGGGCATCTGTTGGACTTTCCACCTGGTCATATAC
 321 TCTGCAGCTGTTAGAATGTGCAAGCACTTGGGGACAGCATGAGCTTGCTGTTGTACACAGGGTATTTCTAGAAGCAGAAA
 401 TAGACTGGGAAGATGCACAACCAAGGGGTTACAGGCATCGCCCATGCTCCTCACCTGTATTTTGTAATCAGAAATAAATT
 481 GCTTTTAAAGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agACAUUUAUAGG-----GAAACGGACu 5' ||| ||| ||| | ||||||| Target 5' acTGTTAAT-TCCTCATGCGTTGCCTGc 3'	12 - 38	160.00	-17.60
2	miRNA 3' agaCAUUUAU--AGGG---AAACGGACu 5' || | |: |||| ||||:|| Target 5' ttaGTCACTGCCTCCCGAAGTTGCTTGa 3'	144 - 171	134.00	-15.80
3	miRNA 3' agACAUUUAUAGGGAAACGGAcu 5' || |::|:| | ||| :|| Target 5' tgTGCAGGTGT-CATTTATCTat 3'	187 - 208	96.00	-6.40

Mutant ID	Mutant Position	Mutant Source
COSN19730806	2	COSMIC
COSN30468150	5	COSMIC
COSN7447798	7	COSMIC
COSN29467418	33	COSMIC
COSN31588229	51	COSMIC
COSN4968128	116	COSMIC
COSN24471146	183	COSMIC
COSN21548243	210	COSMIC
COSN1770297	368	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs947324883	3	dbSNP
rs755260110	7	dbSNP
rs781605869	12	dbSNP
rs1291627398	14	dbSNP
rs757926346	14	dbSNP
rs1349146763	15	dbSNP
rs748359722	16	dbSNP
rs777411635	16	dbSNP
rs770058728	23	dbSNP
rs1235148949	24	dbSNP
rs773357213	30	dbSNP
rs375045303	31	dbSNP
rs771292453	34	dbSNP
rs1261267514	37	dbSNP
rs1447964961	41	dbSNP
rs774809592	44	dbSNP
rs1395786606	45	dbSNP
rs1325487022	48	dbSNP
rs116432725	49	dbSNP
rs767898504	50	dbSNP
rs1357399343	51	dbSNP
rs1455133317	53	dbSNP
rs1289291461	56	dbSNP
rs1383784108	58	dbSNP
rs1360960890	61	dbSNP
rs559917649	64	dbSNP
rs374049330	68	dbSNP
rs763601268	69	dbSNP
rs1311610587	71	dbSNP
rs1475127472	72	dbSNP
rs948583382	75	dbSNP
rs1195628882	78	dbSNP
rs1045108313	79	dbSNP
rs1268582057	98	dbSNP
rs1342276263	101	dbSNP
rs928086843	103	dbSNP
rs1269776926	119	dbSNP
rs1360107909	121	dbSNP
rs779055873	129	dbSNP
rs1275069095	130	dbSNP
rs1036370708	133	dbSNP
rs552201860	140	dbSNP
rs897862243	141	dbSNP
rs887814471	147	dbSNP
rs1006460149	152	dbSNP
rs1267995998	155	dbSNP
rs181151870	160	dbSNP
rs531536134	161	dbSNP
rs1340790338	162	dbSNP
rs1302284227	164	dbSNP
rs1442441488	165	dbSNP
rs1367296496	167	dbSNP
rs1165410066	168	dbSNP
rs1409398617	178	dbSNP
rs970191413	180	dbSNP
rs748097744	181	dbSNP
rs701717	183	dbSNP
rs568251536	187	dbSNP
rs901600577	194	dbSNP
rs1476189763	201	dbSNP
rs540983626	206	dbSNP
rs777442223	209	dbSNP
rs1204467903	218	dbSNP
rs1031332641	219	dbSNP
rs535982599	222	dbSNP
rs1270240490	224	dbSNP
rs1219993937	226	dbSNP
rs372002774	227	dbSNP
rs914226711	231	dbSNP
rs1221395393	233	dbSNP
rs968386095	237	dbSNP
rs1172272813	246	dbSNP
rs1441354344	254	dbSNP
rs1352739508	258	dbSNP
rs771825858	261	dbSNP
rs111293410	264	dbSNP
rs112698875	265	dbSNP
rs150621982	265	dbSNP
rs911155344	267	dbSNP
rs1174564526	268	dbSNP
rs12985239	269	dbSNP
rs190588011	270	dbSNP
rs771309357	276	dbSNP
rs939450679	282	dbSNP
rs918447962	285	dbSNP
rs1199981300	286	dbSNP
rs1457831092	287	dbSNP
rs1298613131	289	dbSNP
rs141452481	293	dbSNP
rs1313625255	295	dbSNP
rs1231831849	300	dbSNP
rs1048300888	303	dbSNP
rs1223059540	305	dbSNP
rs10425778	306	dbSNP
rs576378187	319	dbSNP
rs1345586392	321	dbSNP
rs1311376231	329	dbSNP
rs757751691	330	dbSNP
rs1044629754	337	dbSNP
rs775574286	339	dbSNP
rs1467747103	345	dbSNP
rs1281512747	347	dbSNP
rs537341906	349	dbSNP
rs943483378	353	dbSNP
rs1040548961	356	dbSNP
rs1382638625	358	dbSNP
rs8113219	359	dbSNP
rs998606617	360	dbSNP
rs1192122202	361	dbSNP
rs573871387	362	dbSNP
rs1478635098	371	dbSNP
rs1181269687	379	dbSNP
rs1241948127	379	dbSNP
rs1484021372	380	dbSNP
rs1009977309	382	dbSNP
rs1256291428	386	dbSNP
rs1214724963	395	dbSNP
rs1021808242	397	dbSNP
rs1288013696	399	dbSNP
rs376473637	402	dbSNP
rs1381998048	403	dbSNP
rs1405793977	404	dbSNP
rs1397923111	408	dbSNP
rs1380162625	410	dbSNP
rs985092863	415	dbSNP
rs1428999502	421	dbSNP
rs1022805905	423	dbSNP
rs1424555353	425	dbSNP
rs1458914057	428	dbSNP
rs867543724	435	dbSNP
rs1425043993	436	dbSNP
rs1256350347	437	dbSNP
rs1185599123	438	dbSNP
rs368813578	440	dbSNP
rs11539144	441	dbSNP
rs1325270588	443	dbSNP
rs1358632418	444	dbSNP
rs1035522648	445	dbSNP
rs1247004831	448	dbSNP
rs1322424426	449	dbSNP
rs3203517	451	dbSNP
rs1380710573	454	dbSNP
rs1342662445	456	dbSNP
rs977113983	458	dbSNP
rs972156436	463	dbSNP
rs11669553	465	dbSNP
rs1458952049	466	dbSNP
rs1368574080	470	dbSNP
rs754235045	471	dbSNP
rs984797773	474	dbSNP
rs1194116993	476	dbSNP
rs910768467	476	dbSNP
rs56100750	480	dbSNP
rs564066505	482	dbSNP
rs909299629	483	dbSNP
rs139495767	485	dbSNP
rs1211593654	490	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.