>COL23A1|NM_173465|3'UTR
   1 CCCACAGGCCCAGCTCACACCTGTACAGATCCGTGTGGACATTTTTAATTTTTGTAAAAACAAAACAGTAATATATTGAT
  81 CTTTTTTCATGGAATGCGCTACCTGTGGCCTTTTAACATTCAAGAGTATGCCCACCCAGCCCCAAAGCCACCGGCATGTG
 161 AAGCTGCCGGAAAGTGGACAGGCCAGACCAGGGAGATGTGTACCTGAGGGGCACCCTTGGGCCTGGGCTTTCCCAGGAAG
 241 GAGATGAAGGTAGAAGCACCTGGCTCGGGCAAGGCTAGAAAGATGCTACGTTGGGCCTTCAGTCACCTGATCAGCAGAGA
 321 GACTCTCAGCTGTGGTACTGCCCTGTAAGAACCTGCCCCCGCAAAACTCTGGAGTCCCTGGGACACACCCTATCCAAGAA
 401 GACCCAGGGGTGGAACAGCGGCTGCTGTTGCTCCTGGCCTCATCAGCCTCCAAACTCAACCACAACCAGCTGCCTCTGCA
 481 GTTGGACAAGACTTGGCCCCCGGACAAGACTCGCCCAGCACTTGCGGCTGGGCCCGGGGAGCAGTGAGTGGAAATCCCCC
 561 ACGAGGGTCTAGCTCTACCACATTCAGGAGGCCTCAGGAGGCCAGCCTGCCATGAGAGCACATGTCCTCTGGCCAGGAGT
 641 AGTGGCTGAGCTCTGTGATCGCTGTGATGTGGACCCAGCTCCAGGGAGCAGAGTGTCGAGGATGGAGGGGCCCAGCCTGG
 721 ACTGACTGCTACTTCCTGTCTCTGTTTCCATTATCACCCAGAGAGGGACAAGATAGGACATGGCCTGGACCAGGGAGGCA
 801 GGCCTCCCACTCAGAGTCTGGGTCTCACTGGCCCCAAGTCTCCCACCCAGAACTCTGGCCAAAAATGGCTCTCTAGGTGG
 881 GCTGTGCAGGCAAAGCAAAGCTCAGGGCTGGTTCCCAGCTGGCCTGAGCAGGGGGCCTGCCACCAGACCCACCCACGCTC
 961 TGACGAGAGGCTTTTCCACCTCCAGCAAGTGTTCCCAGCAACCAGCTCCATCCTGGCTGCTTGCCTTCCATTTCCGTGTA
1041 GATGGAGATCACTGTGTGTAATAAACCACAAGTGCGTGTCTGAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uguAGAUUCUGACGUUCUCAaga 5' |:||| |:| ||||||| Target 5' cctTTTAACATT-CAAGAGTatg 3'	109 - 130	131.00	-8.22
2	miRNA 3' uguagauucuGACGUUCUCAAGa 5' | ||||| |||| Target 5' tttccacctcCAGCAAGTGTTCc 3'	973 - 995	125.00	-10.00
3	miRNA 3' uguAGAUUCUGACGUUCUCA-AGa 5' || |:|: || ||||| || Target 5' agcTCCAGGG-AGC-AGAGTGTCg 3'	677 - 698	118.00	-8.30

Mutant ID	Mutant Position	Mutant Source
COSN30163851	8	COSMIC
COSN18718615	23	COSMIC
COSN30163852	23	COSMIC
COSN31495436	35	COSMIC
COSN30488407	37	COSMIC
COSN30477294	38	COSMIC
COSN14159564	40	COSMIC
COSN26971384	49	COSMIC
COSN8209595	71	COSMIC
COSN31500645	74	COSMIC
COSN31520684	78	COSMIC
COSN30458532	88	COSMIC
COSN30567228	169	COSMIC
COSN20862038	186	COSMIC
COSN28651793	357	COSMIC
COSN31488275	358	COSMIC
COSN31488539	457	COSMIC
COSN30544550	502	COSMIC
COSN30541006	569	COSMIC
COSN31489518	585	COSMIC
COSN9422271	588	COSMIC
COSN26635402	626	COSMIC
COSN28654385	699	COSMIC
COSN25362112	725	COSMIC
COSN20997932	761	COSMIC
COSN23987841	965	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs779307547	2	dbSNP
rs773619714	4	dbSNP
rs1461696179	5	dbSNP
rs746587057	9	dbSNP
rs768195464	18	dbSNP
rs746614048	27	dbSNP
rs1016836886	28	dbSNP
rs963347887	29	dbSNP
rs775174143	32	dbSNP
rs545766417	33	dbSNP
rs193029360	34	dbSNP
rs1254978263	36	dbSNP
rs199586986	37	dbSNP
rs1446703427	38	dbSNP
rs1424941158	39	dbSNP
rs1210565339	42	dbSNP
rs1026335728	60	dbSNP
rs1237276933	63	dbSNP
rs1182714600	65	dbSNP
rs1255877652	66	dbSNP
rs1440285252	68	dbSNP
rs541226510	76	dbSNP
rs1030549078	82	dbSNP
rs1013562164	87	dbSNP
rs998685117	97	dbSNP
rs1156729442	98	dbSNP
rs1382050011	105	dbSNP
rs896578448	107	dbSNP
rs573752756	109	dbSNP
rs1172716626	114	dbSNP
rs1399799870	121	dbSNP
rs1204591838	126	dbSNP
rs1397999276	128	dbSNP
rs1033722523	130	dbSNP
rs1002694912	131	dbSNP
rs1335170882	132	dbSNP
rs58562702	145	dbSNP
rs757542798	148	dbSNP
rs189000256	152	dbSNP
rs543726320	153	dbSNP
rs1052727370	157	dbSNP
rs1279928991	160	dbSNP
rs11740043	167	dbSNP
rs576377093	168	dbSNP
rs932949484	169	dbSNP
rs1278959007	171	dbSNP
rs1047116616	182	dbSNP
rs557802075	187	dbSNP
rs1239478357	189	dbSNP
rs929473976	200	dbSNP
rs539022515	208	dbSNP
rs1544925	213	dbSNP
rs943099941	215	dbSNP
rs909405325	226	dbSNP
rs1173344187	235	dbSNP
rs910526895	236	dbSNP
rs553580259	246	dbSNP
rs1401134202	257	dbSNP
rs536084994	259	dbSNP
rs1299895052	261	dbSNP
rs373060611	266	dbSNP
rs182297389	267	dbSNP
rs1026533065	268	dbSNP
rs1473685108	269	dbSNP
rs1196369223	272	dbSNP
rs967228679	273	dbSNP
rs992160034	282	dbSNP
rs1457867467	283	dbSNP
rs1212965419	286	dbSNP
rs1265231834	289	dbSNP
rs111977623	290	dbSNP
rs1199245170	291	dbSNP
rs1181547195	293	dbSNP
rs1490550797	295	dbSNP
rs1034086518	297	dbSNP
rs1401110094	301	dbSNP
rs1461035804	307	dbSNP
rs1292265478	322	dbSNP
rs1393469575	334	dbSNP
rs1033987715	335	dbSNP
rs1450985028	347	dbSNP
rs1284665926	355	dbSNP
rs1544926	357	dbSNP
rs1326636326	360	dbSNP
rs191281464	361	dbSNP
rs994191162	366	dbSNP
rs1021473828	368	dbSNP
rs773097971	370	dbSNP
rs1232099740	372	dbSNP
rs527641841	382	dbSNP
rs897962351	403	dbSNP
rs1011331920	409	dbSNP
rs560683991	413	dbSNP
rs1260757254	416	dbSNP
rs147499289	420	dbSNP
rs1236063659	425	dbSNP
rs766984257	436	dbSNP
rs1196071092	441	dbSNP
rs1369010253	442	dbSNP
rs1053005590	453	dbSNP
rs1424662706	460	dbSNP
rs942088378	461	dbSNP
rs1291314721	473	dbSNP
rs889184424	486	dbSNP
rs1434882793	487	dbSNP
rs1458857503	492	dbSNP
rs1158566903	495	dbSNP
rs1349861757	497	dbSNP
rs1402300416	500	dbSNP
rs529120715	502	dbSNP
rs756751505	512	dbSNP
rs747925970	513	dbSNP
rs943150356	516	dbSNP
rs1158632695	518	dbSNP
rs1245420665	523	dbSNP
rs773903641	525	dbSNP
rs144930911	526	dbSNP
rs543607386	529	dbSNP
rs1263641134	530	dbSNP
rs1049235121	535	dbSNP
rs929418977	536	dbSNP
rs1258348949	537	dbSNP
rs919420833	538	dbSNP
rs958557574	540	dbSNP
rs1158992235	543	dbSNP
rs1189594363	544	dbSNP
rs935902789	555	dbSNP
rs992443308	556	dbSNP
rs960931368	559	dbSNP
rs926665909	560	dbSNP
rs1378953961	561	dbSNP
rs375850702	562	dbSNP
rs1159558449	563	dbSNP
rs968170342	567	dbSNP
rs1375234991	573	dbSNP
rs1465220830	576	dbSNP
rs148790360	577	dbSNP
rs1380665391	581	dbSNP
rs1463330861	585	dbSNP
rs13179085	597	dbSNP
rs1396151904	599	dbSNP
rs987738093	604	dbSNP
rs1374490567	610	dbSNP
rs1009606182	616	dbSNP
rs1203862169	619	dbSNP
rs1311460767	623	dbSNP
rs770552876	625	dbSNP
rs1025742154	627	dbSNP
rs1258039582	627	dbSNP
rs993738062	634	dbSNP
rs1236437307	637	dbSNP
rs1031452635	643	dbSNP
rs1298537151	645	dbSNP
rs545828873	648	dbSNP
rs1016497323	651	dbSNP
rs1218176919	660	dbSNP
rs1367515937	661	dbSNP
rs901733288	662	dbSNP
rs1038708766	671	dbSNP
rs1360481520	674	dbSNP
rs539462322	676	dbSNP
rs187172747	685	dbSNP
rs1437921012	693	dbSNP
rs887535142	697	dbSNP
rs553864287	698	dbSNP
rs13741	699	dbSNP
rs1217216443	700	dbSNP
rs1361155964	701	dbSNP
rs1303175908	703	dbSNP
rs1174037312	707	dbSNP
rs1414035496	709	dbSNP
rs1198265023	710	dbSNP
rs1411634515	725	dbSNP
rs1256221266	728	dbSNP
rs1459197336	733	dbSNP
rs1042129617	744	dbSNP
rs1420328806	744	dbSNP
rs1246684648	758	dbSNP
rs1487802559	760	dbSNP
rs919451036	767	dbSNP
rs1447614473	769	dbSNP
rs1056625693	774	dbSNP
rs1433398811	776	dbSNP
rs945957638	777	dbSNP
rs1247128241	785	dbSNP
rs777577385	786	dbSNP
rs1420796935	793	dbSNP
rs914479570	794	dbSNP
rs1331469878	804	dbSNP
rs1349190915	807	dbSNP
rs1054399073	812	dbSNP
rs73336866	816	dbSNP
rs926836381	818	dbSNP
rs980799996	819	dbSNP
rs1218240507	842	dbSNP
rs144243981	847	dbSNP
rs981181817	850	dbSNP
rs747978203	853	dbSNP
rs13993	856	dbSNP
rs1289279946	857	dbSNP
rs1450319142	868	dbSNP
rs1307508503	884	dbSNP
rs918227978	887	dbSNP
rs915237449	904	dbSNP
rs988214385	908	dbSNP
rs972795390	909	dbSNP
rs781660146	916	dbSNP
rs1276162786	918	dbSNP
rs1488192590	920	dbSNP
rs1231207712	923	dbSNP
rs1363676119	925	dbSNP
rs1260530572	929	dbSNP
rs1297279730	935	dbSNP
rs1167923648	939	dbSNP
rs1397042695	946	dbSNP
rs570815393	947	dbSNP
rs757585359	948	dbSNP
rs1166910281	950	dbSNP
rs751914035	956	dbSNP
rs965996560	962	dbSNP
rs552594694	964	dbSNP
rs1017898008	965	dbSNP
rs1016467550	969	dbSNP
rs1230498538	971	dbSNP
rs1291289648	974	dbSNP
rs1353651640	980	dbSNP
rs1371194840	992	dbSNP
rs1288608118	994	dbSNP
rs1489034432	999	dbSNP
rs1193525239	1004	dbSNP
rs1236379748	1008	dbSNP
rs1471545906	1028	dbSNP
rs1183502321	1035	dbSNP
rs1006461226	1036	dbSNP
rs1419052116	1038	dbSNP
rs1007472230	1041	dbSNP
rs1427715764	1055	dbSNP
rs887472373	1058	dbSNP
rs1389525801	1060	dbSNP
rs1048743813	1061	dbSNP
rs1029119950	1069	dbSNP
rs1165215902	1072	dbSNP
rs993267174	1073	dbSNP
rs897552835	1075	dbSNP
rs149571549	1076	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.