| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4677 |
| Genomic Coordinates | chr1: 243346176 - 243346255 |
| Description | Homo sapiens miR-4677 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4677-3p | ||||||||||||
| Sequence | 50| UCUGUGAGACCAAAGAACUACU |71 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Illumina | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | SEPT8 | ||||||||||||||||||||
| Synonyms | SEP2 | ||||||||||||||||||||
| Description | septin 8 | ||||||||||||||||||||
| Transcript | NM_001098813 | ||||||||||||||||||||
| Other Transcripts | NM_001098811 , NM_001098812 , NM_015146 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on SEPT8 | |||||||||||||||||||||
| 3'UTR of SEPT8 (miRNA target sites are highlighted) |
>SEPT8|NM_001098813|3'UTR 1 CGCACGCACAGACTTACATGTCAAGAGTGGACTTTAGACTTTCATGTGTTAAGTTGCTTGAGTTACACCTTGTGACCCTT 81 CTCCCATAACATGGTGTGAGGACGGACTGGGAGCCGGTACAGACTCCAGTGTTTACAGCCTTGCTTTCCTCCCACCGACC 161 CTGGCCCCAGGCTGCCCCGGGCCTGGCGGGCCACCCCTCTCTATGCAAACACGTAAAAGCCATGAATGCTGGAATCCAAA 241 ACTGACGAGGTTTATTTTTTTCAGAGCCAGTGGCTGGTCTTCCATTTACAGTGTCACTATTCCCTGACGGAGCTGTTATG 321 TGCCGCTCTAGCGAAGGCCCCAGCCGGGATGCTAGGCCTAATTGTTCAGCGTGGAGATGGCAACTCACGTGGTGCCCTAG 401 GTGCAGCTGCGTGGTCTGGTATACATGCTGCAAAATTCACCCAGTTCCCCTCATTTTAATTTTTCTAACCTACAGCTTAA 481 TTTTAATAACTTTAAAACACTTCTAAATATTTATTTTGGCACCAGCGTCAAGACAAATAATATCCTCTCCCATTATTTTC 561 ATAAGTAACACAGATTCCCTGATTTTTAAAAACTAAAAATACAGCTAAACCTTTCTTATGTATAAAGTATGCCTATCATA 641 TACAGGGAGAGGTGGGTAATAAACTTCCTGTAATGACAGTGTTTGGCATTTCTTTATGGATGGAATTGGAACATGAACAA 721 GACCATGTCCAGCGTTTTTACTGTGAATGTAAATGGAACAGCAGCCCAAAGCTGTTGTCTGTGCCCCAGAGGTGCTACCT 801 GTAGACAGGGACCAACTCCATGTGTGTGTGTTAAGTGTTTGACTCCAATTAAGACTCCCAAGCAAATCCTGCATATTCCA 881 AATGTAAAGAGTACTCAGTGGGAAAAAGGTTGTTACCTCAAAGTCATTGCTTCTTTCCTGGCTGGGTCACAGGGTGAAGA 961 GATGAAGGTGTCTGATGTATATAGACAATTAGGGAAAAATGAGCGGCAAAGGAGCTTTCCCCTTCAGCTGCACTCTAAAG 1041 GGGAACATTTTAAGGAAGTACTAGCAGCTTTGACTCTTCTATGCTCCTGTTGGTTTACAAGCCACCAAGAATGTCAGTGT 1121 TGAGAATACGGCCTGGTAAAATGGGAGATGTAAAATGACTAAATGAAAGGAAGGGTAGTTTTAATGTTGAAGCACCGTGC 1201 TGGGCACTGGAGCTACCCAGAGGAATGCACAACGCTCCCCTCAAGGAGCTCACAGTCTAGCCTACTCCCTGGCTGGAAGC 1281 CTCAGGAAGACGTGCTAATTTATTGTGGAATTGGTAGTTTGCTTTTCATGCCCCTGTCTTCCTTCTCATGACCATTTCCC 1361 CCTTTCTGTCTGGCTTGCATTATTGATTTCCAGGACCAAGTCCTGGCTTCCTCCTGCCTTCCTGAGATGATGTTCTGCTC 1441 AGGGAGAAGTGGAGGGGTGAGCTGTGTGTGTCCACCGAGGCACGGCCAGGAAGAGGCAGCCTTTACCTGTGAGGGGCTCC 1521 ATGCTCCAGCAGCAGAGCAGGTTCTAGTGACAATTCAACTTTTTATGCTATGACCAGGGGTGGATCTAAATTTTATGGGG 1601 CTGAAAGCTTGAATTATTTAGAAAGACTTCTTTAAGAAAAACAATGTTAATATAAAATTAGGTACAGGGTCTTGGAAGGG 1681 GCCCTGAAGATTAAGCTTCCTTAGCGTCACAATAAGTCCGTATCTGGTTGCAATTGAAAACTGATGCTTCAGTGAGGGTA 1761 TCTAAAAAGGTAAACTGGCATATCCAGGGCAAATGTGGGCTGCCAATGGCTCATCTCTAGGGTAATTTTATGTCTGAAAG 1841 TGTATGCAGTTGGGTCAGAGCATGACCTTTAAGATAGCCTCTCTCAGCTAACATATTTATGAAGATGAGGCCTGGTGACC 1921 CAGCAGGTTCATTGGATACATAAGAAATGAGAATTCCTGGTTCATGGGCCAACCTAGGACTCTGGAGTATGCAGACTTGG 2001 CCATTCGTCCATTGTGGCCTGCGGGTCGCACCCCAGGCATACTGAAAGGCCATACTCGTGGCTGGCTGCCTGCGGGCCTA 2081 AGCCTTCCCAGGATCTTCAGGACACTTGACAGACTTGTGTTTTCTGGTCTGAGCTGCCTCCACAGGTCCCTCCAGCAAGC 2161 CTCACTGCACCTCTCCCCTGCTGTTTGTGTTTGGAATTTTGTCTTCTTTAGCTGAGACCAAATTAAACCTTGGTGCATAA 2241 AGTGAGCTTAAAACTTGCCACTGTTTAGTAAGTTAGCCCCCATAGAATGTGACCCTGTCTGCAGAGTCTCATTTACCCCT 2321 CTTTTTCTCATTGTCATTTGTTGGCTTTATTAGGGCTGTCTTACAGGATCATGTTGGCATTTACTATCATGTCTTTATCA 2401 TAAACCATGTTTGTTTGAGGTAGAAGAATCACCATATAATTCGTTGCCCAAATTGGGACTATTGAGAGAGAAAGGGGATG 2481 CTATTAATTACACCAGATCAAAAGGCATAAACCAGACCTGTCCCAGGCCGATGTGGAAATATGTTCTTTCTAGTTGTGGG 2561 TACCCTGATCTAGGTGGTTTGTAATTGTGCATTACTGACTGCATATGTTTGTGTATGTGTAAATGTGGGCTCCCTGTTAA 2641 GTGGGGCTCATGGATACGAGGCCTGAGGAAGTGTGGCTTGCTAGTCTGTTACGTTAACATGCTTTTCTAAAATTGCTTCA 2721 CGTGTTAATTCATTTACTCCTGCATTCATTGACTGTTTTTGTTCTTTTCCATTCACTTTGTACTTATTTTTTTCATTAAA 2801 TTTTGCATTTATTTTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 23176.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 23176.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 23176.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293/HeLa |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells)
HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells)
... - Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology. |
| Article |
- Kishore S; Gruber AR; Jedlinski DJ; Syed et al. - Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 8 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MDA-MB-231 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1395171. RNA binding protein: AGO. Condition:MDA-MB-231 AGO HITS-CLIP Replicate 3
... - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment. |
| Article |
- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al. - Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
|
| CLIP-seq Support 1 for dataset GSM4850315 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / AGO_CLIP_Rep1 |
| Location of target site | NM_001098812 | 3UTR | UCAAGGAGCUCACAGUCUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM4850316 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / AGO_CLIP_Rep2 |
| Location of target site | NM_001098812 | 3UTR | UCAAGGAGCUCACAGUCUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM4850317 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / miRNA_WT |
| Location of target site | NM_001098812 | 3UTR | UCAAGGAGCUCACAGUCUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM4850318 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / miRNA_H41R |
| Location of target site | NM_001098812 | 3UTR | UCAAGGAGCUCACAGUCUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000378706.1 | 3UTR | CCUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM714643 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1067869 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (asynchronous cells) |
| Location of target site | ENST00000378706.1 | 3UTR | CCCUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23706177 / GSE43666 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1067870 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (mitotic cells) |
| Location of target site | ENST00000378706.1 | 3UTR | CCCUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23706177 / GSE43666 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1395171 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | MDA-MB-231 / MDA-MB-231 AGO HITS-CLIP Replicate 3 |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24906430 / GSE57855 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 12 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 13 for dataset GSM714646 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repA |
| Location of target site | ENST00000378706.1 | 3UTR | UCCCCUCAAGGAGCUCACAGUCUAGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 14 for dataset GSM714647 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repB |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 15 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 16 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 17 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000378706.1 | 3UTR | UCAAGGAGCUCACAGUCUAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 18 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 19 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 20 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 21 for dataset GSM1462573 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl BaL |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 22 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000378706.1 | 3UTR | CUCAAGGAGCUCACAGUCUAGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
61 hsa-miR-4677-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT277530 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 |  |
|
2 | 2 | ||||||
| MIRT296646 | RPS21 | ribosomal protein S21 | |
|
2 | 4 | ||||||
| MIRT306961 | THRB | thyroid hormone receptor beta | |
|
2 | 2 | ||||||
| MIRT439091 | MYC | MYC proto-oncogene, bHLH transcription factor | 0 | 1 | ||||||||
| MIRT443953 | LRIT3 | leucine rich repeat, Ig-like and transmembrane domains 3 | |
|
2 | 2 | ||||||
| MIRT445487 | KLF12 | Kruppel like factor 12 | |
|
2 | 2 | ||||||
| MIRT446637 | SDC3 | syndecan 3 | |
|
2 | 2 | ||||||
| MIRT448594 | PCP4L1 | Purkinje cell protein 4 like 1 | |
|
2 | 2 | ||||||
| MIRT449822 | FNBP1 | formin binding protein 1 | |
|
2 | 2 | ||||||
| MIRT450422 | BCL2L14 | BCL2 like 14 | |
|
2 | 2 | ||||||
| MIRT454907 | SEPT8 | septin 8 | |
|
2 | 17 | ||||||
| MIRT466442 | TFAM | transcription factor A, mitochondrial | |
|
2 | 6 | ||||||
| MIRT474198 | LEPRE1 | prolyl 3-hydroxylase 1 | |
1 | 1 | |||||||
| MIRT474486 | KLHDC8B | kelch domain containing 8B | |
|
2 | 2 | ||||||
| MIRT474900 | KCTD21 | potassium channel tetramerization domain containing 21 | |
|
2 | 2 | ||||||
| MIRT477670 | EFHD2 | EF-hand domain family member D2 | |
|
2 | 2 | ||||||
| MIRT483912 | GNB1L | G protein subunit beta 1 like | |
|
2 | 2 | ||||||
| MIRT484163 | FAM71B | family with sequence similarity 71 member B | |
|
2 | 2 | ||||||
| MIRT487565 | LOXL2 | lysyl oxidase like 2 | |
|
2 | 2 | ||||||
| MIRT489678 | CYP1A1 | cytochrome P450 family 1 subfamily A member 1 | |
|
2 | 2 | ||||||
| MIRT491482 | APC2 | APC2, WNT signaling pathway regulator | |
|
2 | 6 | ||||||
| MIRT492745 | PER1 | period circadian clock 1 | |
|
2 | 10 | ||||||
| MIRT499212 | CHRDL1 | chordin like 1 | |
|
2 | 4 | ||||||
| MIRT501197 | SUMO1 | small ubiquitin-like modifier 1 | |
|
2 | 2 | ||||||
| MIRT522622 | MAP7D1 | MAP7 domain containing 1 | |
|
2 | 4 | ||||||
| MIRT523971 | DVL3 | dishevelled segment polarity protein 3 | |
|
2 | 2 | ||||||
| MIRT541017 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | |
|
2 | 2 | ||||||
| MIRT554741 | RHOC | ras homolog family member C | |
|
2 | 2 | ||||||
| MIRT558910 | CBX5 | chromobox 5 | |
|
2 | 2 | ||||||
| MIRT561466 | TCEB3 | elongin A | |
|
2 | 2 | ||||||
| MIRT564039 | BIRC5 | baculoviral IAP repeat containing 5 | |
|
2 | 2 | ||||||
| MIRT564508 | DUSP3 | dual specificity phosphatase 3 | |
|
2 | 2 | ||||||
| MIRT566854 | LRRC58 | leucine rich repeat containing 58 | |
|
2 | 2 | ||||||
| MIRT574110 | SPINT2 | serine peptidase inhibitor, Kunitz type 2 | |
|
2 | 2 | ||||||
| MIRT611056 | DAB2 | DAB2, clathrin adaptor protein | |
|
2 | 2 | ||||||
| MIRT615578 | NCS1 | neuronal calcium sensor 1 | |
|
2 | 2 | ||||||
| MIRT615742 | EIF4EBP1 | eukaryotic translation initiation factor 4E binding protein 1 | |
|
2 | 2 | ||||||
| MIRT626785 | IL18RAP | interleukin 18 receptor accessory protein | |
|
2 | 2 | ||||||
| MIRT627338 | TTLL7 | tubulin tyrosine ligase like 7 | |
|
2 | 2 | ||||||
| MIRT629039 | KLLN | killin, p53-regulated DNA replication inhibitor | |
|
2 | 2 | ||||||
| MIRT637643 | RASGRP1 | RAS guanyl releasing protein 1 | |
|
2 | 2 | ||||||
| MIRT641769 | ZNF207 | zinc finger protein 207 | |
|
2 | 2 | ||||||
| MIRT645719 | PTPRF | protein tyrosine phosphatase, receptor type F | |
|
2 | 2 | ||||||
| MIRT652155 | TRIM71 | tripartite motif containing 71 | |
|
2 | 2 | ||||||
| MIRT659216 | CXXC5 | CXXC finger protein 5 | |
|
2 | 2 | ||||||
| MIRT661995 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
|
2 | 2 | ||||||
| MIRT662711 | C10orf111 | chromosome 10 open reading frame 111 | |
|
2 | 4 | ||||||
| MIRT663216 | ZNF277 | zinc finger protein 277 | |
|
2 | 2 | ||||||
| MIRT668715 | DIP2C | disco interacting protein 2 homolog C | |
|
2 | 2 | ||||||
| MIRT675132 | FSD2 | fibronectin type III and SPRY domain containing 2 | |
|
2 | 2 | ||||||
| MIRT686180 | ZNHIT6 | zinc finger HIT-type containing 6 | |
|
2 | 2 | ||||||
| MIRT695993 | SNX19 | sorting nexin 19 | |
|
2 | 2 | ||||||
| MIRT702346 | KLHL7 | kelch like family member 7 | |
|
2 | 2 | ||||||
| MIRT702702 | IPO9 | importin 9 | |
|
2 | 2 | ||||||
| MIRT708232 | PPP1R26 | protein phosphatase 1 regulatory subunit 26 | |
|
2 | 2 | ||||||
| MIRT713311 | SNRNP25 | small nuclear ribonucleoprotein U11/U12 subunit 25 | |
|
2 | 2 | ||||||
| MIRT713528 | PAFAH2 | platelet activating factor acetylhydrolase 2 | |
|
2 | 2 | ||||||
| MIRT714651 | FSTL1 | follistatin like 1 | |
|
2 | 2 | ||||||
| MIRT715549 | FPGS | folylpolyglutamate synthase | |
|
2 | 2 | ||||||
| MIRT724289 | KCNMB1 | potassium calcium-activated channel subfamily M regulatory beta subunit 1 | |
|
2 | 2 | ||||||
| MIRT724433 | TFCP2L1 | transcription factor CP2 like 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|