miRTarBase - #MIRT455038


—
pre-miRNA Information
pre-miRNA hsa-mir-4665   
Genomic Coordinates chr9: 6007826 - 6007904
Description Homo sapiens miR-4665 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4665-5p
Sequence 10| CUGGGGGACGCGUGAGCGCGAGC |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs901542342 1 dbSNP
rs1170299887 2 dbSNP
rs747546692 3 dbSNP
rs1260840238 4 dbSNP
rs1377576716 5 dbSNP
rs1349863083 6 dbSNP
rs933050749 7 dbSNP
rs1236802314 11 dbSNP
rs1050148325 12 dbSNP
rs1198393802 14 dbSNP
rs771241090 19 dbSNP
rs1258201615 20 dbSNP
rs1485839367 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MEN1   
Synonyms MEAI, SCG2
Description menin 1
Transcript NM_000244   
Other Transcripts NM_130799 , NM_130800 , NM_130801 , NM_130802 , NM_130803 , NM_130804   
Expression
Putative miRNA Targets on MEN1
3'UTR of MEN1
(miRNA target sites are highlighted)		 
>MEN1|NM_000244|3'UTR
   1 ACTACTGGGGACTTCGGACCGCTTGTGGGGACCCAGGCTCCGCCCTTAGTCCCCCAACTCTGAGCCCATGTTCTGCCCCC
  81 AGCCCAAAGGGGACAGGCCTCACCTCTACCCAAACCCTAGGTTCCCGGTCCCGAGTACAGTCTGTATCAAACCCACGATT
 161 TTCTCCAGCTCAGAACCCAGGGCTCTGCCCCAGTCGTTAGAATATAGGTCTCTTCTCCCAGAATCCCAGCCGGCCAATGG
 241 AAACCTCACGCTGGGTCCTAATTACCAGTCTTTAAAGGCCCAGCCCCTAGAAACCCAAGCTCCTCCTCGGAACCGCTCAC
 321 CTAGAGCCAGACCAACGTTACTCAGGGCTCCTCCCAGCTTGTAGGAGCTGAGGTTTCACCCTTAACCCAAGGAGCACAGG
 401 TCCCACCTCCAGCCCGGGAGCCTAGGACCACTCAGCCCCTAGGAGTATATTTCCGCACTTCAGAATTCCATATCTTGCGA
 481 ATCCAAGCTCCCTGCCCCAAATAACTTCAGTCCTGCTCCAGAATTTGGAAATCCTAGTTTCCTCTCCTTCGTATCCCGAG
 561 TCTGGGACACAAAACTCCGCCCCCAGCCTATGAGCATCCTGAGCCCCGCCCTCTTCCTGACGAAACTGGCCCCGGATCAG
 641 AGCAGGACCTCCCTTCCGACCCTCTGGGAACCTCCCAGAGGTCCAGCCCATCTCGGAGCATCCCGGAGGAAATCTGCAGA
 721 GGGTTAGGAGTGGGTGACAAGAGCCTGATCTCTTCCTGTTTTGTACATAGATTTATTTTTCAGTTCCAAGAAAGATGAAT
 801 ACATTTTGTTAAAAAAAATAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgaGCGCGAGUGCGCAGGGGGUc 5'
             ||| ||:|   |||||||| 
Target 5' ctcCGCCCTTA---GTCCCCCAa 3'
 38 - 57 161.00 -22.30
2 
miRNA  3' cgagcgcgaguGCGCAGGGGGUc 5'
                     | | ||:|||| 
Target 5' agaatataggtCTCTTCTCCCAg 3'
 199 - 221 128.00 -18.30
3 
miRNA  3' cgAG-CGCGAGUGC--GCAGGGGGUc 5'
            || | || ||:|  |  |||||| 
Target 5' acTCTGAGCCCATGTTCTGCCCCCAg 3'
 57 - 82 127.00 -26.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
560773 16 ClinVar
305312 89 ClinVar
305311 104 ClinVar
880309 126 ClinVar
580649 133 ClinVar
305310 185 ClinVar
879089 245 ClinVar
305309 272 ClinVar
305308 302 ClinVar
305307 307 ClinVar
305306 309 ClinVar
878508 341 ClinVar
305305 373 ClinVar
305304 392 ClinVar
878507 400 ClinVar
446503 412 ClinVar
305303 438 ClinVar
305302 470 ClinVar
305301 527 ClinVar
305300 529 ClinVar
305299 533 ClinVar
305298 557 ClinVar
305297 560 ClinVar
305296 570 ClinVar
877477 693 ClinVar
305295 794 ClinVar
572762 821 ClinVar
COSN32057079 20 COSMIC
COSN26984199 28 COSMIC
COSN13339832 42 COSMIC
COSN30458209 45 COSMIC
COSN30159763 73 COSMIC
COSN26602536 83 COSMIC
COSN31492395 85 COSMIC
COSN30473338 90 COSMIC
COSN31506324 126 COSMIC
COSN21014258 225 COSMIC
COSN24157640 241 COSMIC
COSN22079254 550 COSMIC
COSN31516045 770 COSMIC
COSN31520248 805 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs955479842 1 dbSNP
rs1258520848 2 dbSNP
rs769076890 3 dbSNP
rs749702261 9 dbSNP
rs1266059159 14 dbSNP
rs1276106671 15 dbSNP
rs140924477 16 dbSNP
rs756547560 17 dbSNP
rs71581749 18 dbSNP
rs746452984 20 dbSNP
rs781117541 25 dbSNP
rs768424332 35 dbSNP
rs1312973646 37 dbSNP
rs749255998 38 dbSNP
rs757368629 41 dbSNP
rs994749940 42 dbSNP
rs751711071 48 dbSNP
rs764327356 50 dbSNP
rs758136062 51 dbSNP
rs962969824 55 dbSNP
rs866086933 58 dbSNP
rs1012529849 61 dbSNP
rs1057067406 62 dbSNP
rs934731720 69 dbSNP
rs894138469 70 dbSNP
rs1274602417 80 dbSNP
rs1352103616 81 dbSNP
rs886048478 89 dbSNP
rs1002540892 96 dbSNP
rs1266352169 102 dbSNP
rs886048477 104 dbSNP
rs1214571397 105 dbSNP
rs1269817005 110 dbSNP
rs1256611314 113 dbSNP
rs1196539126 121 dbSNP
rs138595686 126 dbSNP
rs1161196544 131 dbSNP
rs1385818012 135 dbSNP
rs945887648 137 dbSNP
rs910398618 145 dbSNP
rs914432880 146 dbSNP
rs933233074 156 dbSNP
rs1054765306 157 dbSNP
rs922925005 167 dbSNP
rs971796209 172 dbSNP
rs1286939851 173 dbSNP
rs942624965 174 dbSNP
rs1314877234 175 dbSNP
rs1245663728 183 dbSNP
rs1329070414 183 dbSNP
rs111895237 185 dbSNP
rs986801624 189 dbSNP
rs1382219825 190 dbSNP
rs1209421368 192 dbSNP
rs1310257524 200 dbSNP
rs769487374 200 dbSNP
rs1449350739 205 dbSNP
rs1374357126 209 dbSNP
rs1184060315 210 dbSNP
rs1409756384 215 dbSNP
rs1164926878 218 dbSNP
rs1472208065 218 dbSNP
rs1369646443 224 dbSNP
rs1297435677 231 dbSNP
rs955407339 235 dbSNP
rs1456094484 253 dbSNP
rs1016047144 259 dbSNP
rs1458312160 260 dbSNP
rs1351572569 261 dbSNP
rs918686885 267 dbSNP
rs972866675 269 dbSNP
rs577302942 270 dbSNP
rs563783609 272 dbSNP
rs868213743 274 dbSNP
rs1423462563 275 dbSNP
rs1017137197 277 dbSNP
rs371871320 284 dbSNP
rs1013086815 286 dbSNP
rs1244346373 287 dbSNP
rs959620501 294 dbSNP
rs1275688507 295 dbSNP
rs1804849 302 dbSNP
rs1804848 307 dbSNP
rs143341556 309 dbSNP
rs906939612 311 dbSNP
rs555709836 324 dbSNP
rs1043117142 326 dbSNP
rs184826203 333 dbSNP
rs888918274 335 dbSNP
rs1163446665 336 dbSNP
rs892949876 341 dbSNP
rs747634476 342 dbSNP
rs573165205 343 dbSNP
rs1050285525 344 dbSNP
rs1370297215 361 dbSNP
rs1242543802 362 dbSNP
rs1305046348 365 dbSNP
rs942554403 370 dbSNP
rs886048476 373 dbSNP
rs553038299 382 dbSNP
rs886048475 392 dbSNP
rs933222929 393 dbSNP
rs1351825181 400 dbSNP
rs911148642 407 dbSNP
rs1051063442 409 dbSNP
rs972128957 412 dbSNP
rs933961932 416 dbSNP
rs1306638101 418 dbSNP
rs918625400 420 dbSNP
rs973221244 436 dbSNP
rs908891279 437 dbSNP
rs886048474 438 dbSNP
rs869238838 441 dbSNP
rs1182498496 442 dbSNP
rs1217417677 444 dbSNP
rs1450978350 447 dbSNP
rs1291715712 449 dbSNP
rs1186207592 455 dbSNP
rs1389958587 456 dbSNP
rs1404323797 457 dbSNP
rs969115913 461 dbSNP
rs1178679937 462 dbSNP
rs778272737 470 dbSNP
rs1159960277 472 dbSNP
rs1465963052 479 dbSNP
rs991654558 492 dbSNP
rs1390879815 495 dbSNP
rs991013729 498 dbSNP
rs555937274 503 dbSNP
rs1362874005 508 dbSNP
rs1035973744 513 dbSNP
rs1035254901 516 dbSNP
rs545890111 526 dbSNP
rs886048473 527 dbSNP
rs886048472 529 dbSNP
rs967379721 530 dbSNP
rs879327862 533 dbSNP
rs1268214233 538 dbSNP
rs971023190 542 dbSNP
rs1465814134 543 dbSNP
rs147116273 550 dbSNP
rs1206267959 551 dbSNP
rs1011661416 552 dbSNP
rs886048471 557 dbSNP
rs1193337869 558 dbSNP
rs886048470 560 dbSNP
rs1269989512 567 dbSNP
rs886048469 570 dbSNP
rs768323266 575 dbSNP
rs1480415097 576 dbSNP
rs368065487 580 dbSNP
rs1414302099 585 dbSNP
rs556981901 590 dbSNP
rs537254362 592 dbSNP
rs1350728945 595 dbSNP
rs1263949976 601 dbSNP
rs1438813212 602 dbSNP
rs1218919014 606 dbSNP
rs1050234163 621 dbSNP
rs1365137075 629 dbSNP
rs1222834423 630 dbSNP
rs372763032 631 dbSNP
rs901689181 633 dbSNP
rs1234332034 634 dbSNP
rs1313731853 637 dbSNP
rs1252758728 639 dbSNP
rs1451846610 642 dbSNP
rs1223262259 643 dbSNP
rs548368376 643 dbSNP
rs1033225242 644 dbSNP
rs1006740105 645 dbSNP
rs528803192 646 dbSNP
rs1036261231 647 dbSNP
rs71581759 652 dbSNP
rs1804850 653 dbSNP
rs1471880385 655 dbSNP
rs1158089809 657 dbSNP
rs1049236547 658 dbSNP
rs552183901 660 dbSNP
rs916352656 662 dbSNP
rs1303053053 663 dbSNP
rs1349503161 664 dbSNP
rs1467302868 665 dbSNP
rs991602212 672 dbSNP
rs1352309871 677 dbSNP
rs996117310 677 dbSNP
rs1407869147 679 dbSNP
rs933930799 680 dbSNP
rs928814450 681 dbSNP
rs1356356073 682 dbSNP
rs1229690026 693 dbSNP
rs1287373530 700 dbSNP
rs71581758 704 dbSNP
rs1358284019 708 dbSNP
rs977661445 709 dbSNP
rs897145871 711 dbSNP
rs1254391907 714 dbSNP
rs770837677 718 dbSNP
rs1379702993 719 dbSNP
rs1037038302 722 dbSNP
rs34171410 724 dbSNP
rs1480369461 725 dbSNP
rs375525393 736 dbSNP
rs941410112 741 dbSNP
rs1473848200 743 dbSNP
rs1180187004 751 dbSNP
rs909983687 759 dbSNP
rs1384890200 779 dbSNP
rs990926419 782 dbSNP
rs1430618196 793 dbSNP
rs117705251 794 dbSNP
rs1408145935 797 dbSNP
rs748927986 816 dbSNP
rs928163083 817 dbSNP
rs1021625358 819 dbSNP
rs982319626 821 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgagcGCGAGUGCGCAGGGGGUc 5'
               | ||:|   |||||||| 
Target 5' -----CCCUUA---GUCCCCCAa 3'
 		1 - 15
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000377316.2 | 3UTR | CCCUUAGUCCCCCAACUCUGAGCCCAUGUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
123 hsa-miR-4665-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT115350 IGF1R insulin like growth factor 1 receptor 2 8
MIRT144387 SF3B3 splicing factor 3b subunit 3 2 2
MIRT145421 ANKRD13B ankyrin repeat domain 13B 2 4
MIRT146684 MINK1 misshapen like kinase 1 2 2
MIRT178944 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT189772 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT238514 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT366308 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375173 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT442321 WNT9B Wnt family member 9B 2 2
MIRT442581 HOXD9 homeobox D9 2 2
MIRT451170 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 2 2
MIRT451894 ILK integrin linked kinase 2 2
MIRT453620 SLC4A2 solute carrier family 4 member 2 2 2
MIRT454769 STOML3 stomatin like 3 2 2
MIRT455038 MEN1 menin 1 2 2
MIRT455151 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT456891 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457201 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT457373 CAMK2A calcium/calmodulin dependent protein kinase II alpha 2 2
MIRT459190 RCE1 Ras converting CAAX endopeptidase 1 2 2
MIRT462580 MYL12A myosin light chain 12A 2 2
MIRT464669 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT464753 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT464881 UBALD1 UBA like domain containing 1 2 2
MIRT465932 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466013 TMEM189 transmembrane protein 189 2 2
MIRT466905 STK38 serine/threonine kinase 38 2 10
MIRT468421 SETD1B SET domain containing 1B 2 2
MIRT468592 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT468853 RREB1 ras responsive element binding protein 1 2 2
MIRT468900 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469189 RICTOR RPTOR independent companion of MTOR complex 2 2 2
MIRT469305 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469771 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469934 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT470000 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT470585 POTEM POTE ankyrin domain family member M 2 2
MIRT470615 POTEG POTE ankyrin domain family member G 2 2
MIRT470932 PKM pyruvate kinase, muscle 2 2
MIRT472511 NACC1 nucleus accumbens associated 1 2 2
MIRT472843 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT473298 MEX3A mex-3 RNA binding family member A 2 2
MIRT473951 LRRC58 leucine rich repeat containing 58 2 2
MIRT474336 KMT2D lysine methyltransferase 2D 2 2
MIRT474399 KLHL28 kelch like family member 28 2 8
MIRT476487 GATAD2A GATA zinc finger domain containing 2A 2 2
MIRT477597 EFNA3 ephrin A3 2 2
MIRT477857 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT479858 CCDC6 coiled-coil domain containing 6 2 2
MIRT480123 CALR calreticulin 2 2
MIRT480391 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480685 BRPF1 bromodomain and PHD finger containing 1 2 2
MIRT482326 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482513 ACTB actin beta 2 2
MIRT483244 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483282 SLC35C2 solute carrier family 35 member C2 2 4
MIRT483381 SPATA6 spermatogenesis associated 6 2 4
MIRT483416 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483468 STMN3 stathmin 3 2 4
MIRT484178 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484460 DDX6 DEAD-box helicase 6 2 2
MIRT484515 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT484595 SIX3 SIX homeobox 3 2 6
MIRT484738 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485248 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT485592 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485912 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT485954 RTBDN retbindin 2 2
MIRT486597 METTL6 methyltransferase like 6 2 2
MIRT486807 NDOR1 NADPH dependent diflavin oxidoreductase 1 2 2
MIRT486972 STEAP3 STEAP3 metalloreductase 2 4
MIRT487364 C10orf54 V-set immunoregulatory receptor 2 2
MIRT488072 DLGAP3 DLG associated protein 3 2 4
MIRT488150 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488454 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT489027 PRPF4B pre-mRNA processing factor 4B 2 2
MIRT489704 CALML3 calmodulin like 3 2 2
MIRT489757 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490015 PIEZO1 piezo type mechanosensitive ion channel component 1 2 2
MIRT490120 FN3K fructosamine 3 kinase 2 2
MIRT490187 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490313 ANK1 ankyrin 1 2 4
MIRT490595 SLC47A1 solute carrier family 47 member 1 2 4
MIRT491133 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT493027 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT494199 CLIP2 CAP-Gly domain containing linker protein 2 2 2
MIRT495699 PADI1 peptidyl arginine deiminase 1 2 2
MIRT501149 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501413 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501638 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT512047 DIRAS2 DIRAS family GTPase 2 2 4
MIRT519877 ZFP30 ZFP30 zinc finger protein 2 4
MIRT522598 MAP7D1 MAP7 domain containing 1 2 4
MIRT524787 BAG5 BCL2 associated athanogene 5 2 2
MIRT539158 AR androgen receptor 2 2
MIRT555901 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT562543 CCDC71L coiled-coil domain containing 71 like 2 4
MIRT568791 VPS37D VPS37D, ESCRT-I subunit 2 2
MIRT569568 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT570000 COL1A2 collagen type I alpha 2 chain 2 2
MIRT570183 RAP1GAP2 RAP1 GTPase activating protein 2 2 2
MIRT572990 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT574618 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT615354 CCNF cyclin F 2 2
MIRT616091 HOXB5 homeobox B5 2 2
MIRT617658 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT619107 CD40LG CD40 ligand 2 2
MIRT621198 ARPC1B actin related protein 2/3 complex subunit 1B 2 2
MIRT628839 FAM151B family with sequence similarity 151 member B 2 2
MIRT635552 LEPREL1 prolyl 3-hydroxylase 2 2 2
MIRT635703 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 2 2
MIRT646646 FNBP1 formin binding protein 1 2 2
MIRT654905 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 2 2
MIRT655121 PHF7 PHD finger protein 7 2 2
MIRT659457 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 4
MIRT668952 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT684242 TBXA2R thromboxane A2 receptor 2 2
MIRT692701 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT694328 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT712137 TAOK1 TAO kinase 1 2 2
MIRT713672 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT715741 HSD11B1L hydroxysteroid 11-beta dehydrogenase 1 like 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4665 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4665 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4665 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4665 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4665-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4665-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4665-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4665-5p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4665-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4665-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4665-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4665-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4665-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4665-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4665-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-4665-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4665-5p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4665-5p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4665-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission