>NKX2-2|NM_002509|3'UTR
   1 GCGCCGCCCCAACGAGACTCGCGGCCCCAGGCCCAGGCCCCACCCCGGCGGCGGTGGCGGCGAGGAGGCCTCGGTCCTTA
  81 TGGTGGTTATTATTATTATTATAATTATTATTATGGAGTCGAGTTGACTCTCGGCTCCACTAGGGAGGCGCCGGGAGGTT
 161 GCCTGCGTCTCCTTGGAGTGGCAGATTCCACCCACCCAGCTCTGCCCATGCCTCTCCTTCTGAACCTTGGGAGAGGGCTG
 241 AACTCTACGCCGTGTTTACAGAATGTTTGCGCAGCTTCGCTTCTTTGCCTCTCCCCGGGGGGACCAAACCGTCCCAGCGT
 321 TAATGTCGTCACTTGAAAACGAGAAAAAGACCGACCCCCCACCCCTGCTTTCGTGCATTTTGTAAAATATGTTTGTGTGA
 401 GTAGCGATATTGTCAGCCGTCTTCTAAAGCAAGTGGAGAACACTTTAAAAATACAGAGAATTTCTTCCTTTTTTTAAAAA
 481 AAAATAAGAAAATGCTAAATATTTATGGCCATGTAAACGTTCTGACAACTGGTGGCAGATTTCGCTTTTCGTTGTAAATA
 561 TCGGTGGTGATTGTTGCCAAAATGACCTTCAGGACCGGCCTGTTTCCCGTCTGGGTCCAACTCCTTTCTTTGTGGCTTGT
 641 TTGGGTTTGTTTTTTGTTTTGTTTTTGTTTTTGCGTTTTCCCCTGCTTTCTTCCTTTCTCTTTTTATTTTATTGTGCAAA
 721 CATTTCTCAAATATGGAAAAGAAAACCCTGTAGGCAGGGAGCCCTCTGCCCTGTCCTCCGGGCCTTCAGCCCCGAACTTG
 801 GAGCTCAGCTATTCGGCGCGGTTCCCCAACAGCGCCGGGCGCAGAAAGCTTTCGATTTTTTAAATAAGAATTTTAATAAA
 881 AATCCTGTGTTTAAAAAAGAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgGGCUGGAGUGGGUGGGGc 5' |||||| | |||||||| Target 5' gaCCGACC-C-CCCACCCCt 3'	349 - 366	164.00	-29.80
2	miRNA 3' cgGGCUGGAGU---GGGUGGGGc 5' | |:|| || |||||||| Target 5' ccCAGGCC-CAGGCCCCACCCCg 3'	26 - 47	153.00	-31.20
3	miRNA 3' cgGGCUGGAGUGGGUGGGgc 5' | ||:: ||||||||| Target 5' ggCAGATTCCACCCACCCag 3'	180 - 199	146.00	-23.50

Mutant ID	Mutant Position	Mutant Source
COSN20079751	3	COSMIC
COSN30710763	4	COSMIC
COSN30148399	6	COSMIC
COSN30447428	14	COSMIC
COSN26986566	22	COSMIC
COSN31493660	34	COSMIC
COSN30499695	36	COSMIC
COSN30499545	43	COSMIC
COSN30150129	47	COSMIC
COSN30518527	51	COSMIC
COSN30536444	52	COSMIC
COSN4969158	73	COSMIC
COSN31609675	162	COSMIC
COSN28760837	163	COSMIC
COSN5967073	248	COSMIC
COSN21594103	271	COSMIC
COSN28815326	280	COSMIC
COSN31552068	281	COSMIC
COSN30663103	296	COSMIC
COSN30542518	301	COSMIC
COSN26671670	311	COSMIC
COSN26414308	340	COSMIC
COSN31568669	393	COSMIC
COSN30543359	405	COSMIC
COSN30593990	419	COSMIC
COSN28190593	441	COSMIC
COSN1246370	468	COSMIC
COSN31519040	475	COSMIC
COSN6560086	475	COSMIC
COSN8345751	476	COSMIC
COSN30540971	485	COSMIC
COSN31557120	531	COSMIC
COSN22301420	550	COSMIC
COSN26677751	550	COSMIC
COSN27790908	590	COSMIC
COSN8610581	639	COSMIC
COSN20093696	643	COSMIC
COSN1246369	644	COSMIC
COSN1246368	645	COSMIC
COSN26570624	649	COSMIC
COSN15663158	652	COSMIC
COSN1246367	654	COSMIC
COSN20116331	656	COSMIC
COSN29131513	656	COSMIC
COSN18841875	674	COSMIC
COSN18841874	675	COSMIC
COSN26570274	706	COSMIC
COSN31590779	841	COSMIC
COSN31537092	849	COSMIC
COSN32167994	868	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1291143399	3	dbSNP
rs1429162364	4	dbSNP
rs913101561	9	dbSNP
rs1337795342	11	dbSNP
rs572080499	12	dbSNP
rs200098958	13	dbSNP
rs555799303	14	dbSNP
rs758230899	16	dbSNP
rs760583353	18	dbSNP
rs1421668443	20	dbSNP
rs1184772692	25	dbSNP
rs1485501374	31	dbSNP
rs200688411	33	dbSNP
rs1391905131	34	dbSNP
rs1379394865	36	dbSNP
rs767906126	38	dbSNP
rs1427926963	40	dbSNP
rs201916405	41	dbSNP
rs765876244	43	dbSNP
rs774400148	43	dbSNP
rs547090259	44	dbSNP
rs1349679521	46	dbSNP
rs762923306	48	dbSNP
rs1261371877	49	dbSNP
rs199524605	50	dbSNP
rs1300492271	52	dbSNP
rs1363584658	55	dbSNP
rs1225616542	56	dbSNP
rs1269071183	58	dbSNP
rs1005787272	59	dbSNP
rs1329788491	61	dbSNP
rs1395976415	63	dbSNP
rs1287219394	66	dbSNP
rs1431905358	69	dbSNP
rs150594923	73	dbSNP
rs1249872447	82	dbSNP
rs1025809508	92	dbSNP
rs549590914	95	dbSNP
rs1188083521	96	dbSNP
rs1369117348	98	dbSNP
rs1014840048	100	dbSNP
rs1387638949	101	dbSNP
rs141777007	103	dbSNP
rs897172828	103	dbSNP
rs1174915930	104	dbSNP
rs1055968941	109	dbSNP
rs1458117998	115	dbSNP
rs937004367	120	dbSNP
rs1310575439	125	dbSNP
rs1480016557	130	dbSNP
rs1387174216	136	dbSNP
rs896739405	140	dbSNP
rs1335369691	148	dbSNP
rs777615480	149	dbSNP
rs563878343	152	dbSNP
rs1246302489	153	dbSNP
rs1282090269	155	dbSNP
rs1333676955	161	dbSNP
rs904218031	162	dbSNP
rs190343452	163	dbSNP
rs945983909	164	dbSNP
rs1463534424	166	dbSNP
rs1208047146	168	dbSNP
rs913153914	171	dbSNP
rs533481040	173	dbSNP
rs1185451367	178	dbSNP
rs1361421749	181	dbSNP
rs867912520	184	dbSNP
rs912926501	189	dbSNP
rs1304800373	193	dbSNP
rs987286278	196	dbSNP
rs933164621	199	dbSNP
rs922688846	208	dbSNP
rs1410225834	211	dbSNP
rs1456981177	212	dbSNP
rs1223218076	217	dbSNP
rs867578980	219	dbSNP
rs1173702845	225	dbSNP
rs988474312	226	dbSNP
rs35832048	227	dbSNP
rs1397316988	233	dbSNP
rs1280264635	237	dbSNP
rs975928978	243	dbSNP
rs1289771169	246	dbSNP
rs964003215	248	dbSNP
rs1238010729	249	dbSNP
rs781067180	265	dbSNP
rs1256542101	270	dbSNP
rs1318605180	274	dbSNP
rs1347011247	278	dbSNP
rs1198846186	279	dbSNP
rs909920362	288	dbSNP
rs1483387865	295	dbSNP
rs1425706301	297	dbSNP
rs984335714	299	dbSNP
rs564490061	300	dbSNP
rs951594832	301	dbSNP
rs1026325052	303	dbSNP
rs954030089	303	dbSNP
rs866625353	306	dbSNP
rs148043874	311	dbSNP
rs1170358343	316	dbSNP
rs1015586709	318	dbSNP
rs1034089130	321	dbSNP
rs145444905	325	dbSNP
rs1348192192	326	dbSNP
rs904183896	330	dbSNP
rs1301687922	340	dbSNP
rs866360971	341	dbSNP
rs555414913	350	dbSNP
rs1042704224	352	dbSNP
rs1009912936	353	dbSNP
rs1342998911	355	dbSNP
rs541730294	360	dbSNP
rs1043883053	361	dbSNP
rs1258786314	362	dbSNP
rs1192204946	373	dbSNP
rs1214957441	376	dbSNP
rs575784781	390	dbSNP
rs912980403	393	dbSNP
rs541305592	405	dbSNP
rs1368362488	406	dbSNP
rs1461173045	406	dbSNP
rs933152122	418	dbSNP
rs1230312674	419	dbSNP
rs1384822883	424	dbSNP
rs1302607549	428	dbSNP
rs117715076	438	dbSNP
rs1230752192	442	dbSNP
rs539109232	445	dbSNP
rs1282872928	447	dbSNP
rs1307191775	452	dbSNP
rs943690891	452	dbSNP
rs1370136309	454	dbSNP
rs780789158	456	dbSNP
rs985792012	456	dbSNP
rs953972407	469	dbSNP
rs1453611613	471	dbSNP
rs1039783836	474	dbSNP
rs41309908	475	dbSNP
rs1190024290	476	dbSNP
rs1423208840	476	dbSNP
rs553704906	476	dbSNP
rs1165074430	477	dbSNP
rs1369786963	483	dbSNP
rs1015638902	485	dbSNP
rs200218028	485	dbSNP
rs984054303	485	dbSNP
rs1437173083	487	dbSNP
rs951401795	490	dbSNP
rs1361364996	491	dbSNP
rs1228924057	492	dbSNP
rs918826487	494	dbSNP
rs117031945	498	dbSNP
rs568059760	506	dbSNP
rs1233104316	507	dbSNP
rs1428060056	509	dbSNP
rs1199658991	510	dbSNP
rs1434594669	517	dbSNP
rs1259343234	518	dbSNP
rs1207408773	530	dbSNP
rs753445250	535	dbSNP
rs1241999902	538	dbSNP
rs993515114	540	dbSNP
rs1485270531	544	dbSNP
rs1181909841	545	dbSNP
rs1033672408	550	dbSNP
rs574735907	551	dbSNP
rs1034967996	552	dbSNP
rs1001704039	563	dbSNP
rs755895960	569	dbSNP
rs1344486403	572	dbSNP
rs1448913545	579	dbSNP
rs1304630739	584	dbSNP
rs1486117272	586	dbSNP
rs904103167	590	dbSNP
rs1289162514	593	dbSNP
rs968421537	596	dbSNP
rs1043953422	597	dbSNP
rs1021396455	601	dbSNP
rs1009747540	602	dbSNP
rs184668111	603	dbSNP
rs1210289448	606	dbSNP
rs1238686654	608	dbSNP
rs892601212	609	dbSNP
rs1186788935	620	dbSNP
rs1252037741	623	dbSNP
rs1321503966	630	dbSNP
rs1052877500	632	dbSNP
rs1414969242	635	dbSNP
rs943770954	636	dbSNP
rs201504278	639	dbSNP
rs374626336	640	dbSNP
rs1440512692	641	dbSNP
rs932598255	642	dbSNP
rs879046378	643	dbSNP
rs1018699553	646	dbSNP
rs201876881	649	dbSNP
rs201764144	654	dbSNP
rs112294834	655	dbSNP
rs1363199114	656	dbSNP
rs200248034	656	dbSNP
rs1209469310	659	dbSNP
rs71182305	661	dbSNP
rs879117513	661	dbSNP
rs1483815747	663	dbSNP
rs1451148528	666	dbSNP
rs1202268518	667	dbSNP
rs879246522	667	dbSNP
rs1478202355	671	dbSNP
rs1404694029	673	dbSNP
rs140543527	674	dbSNP
rs376343795	674	dbSNP
rs398035511	674	dbSNP
rs1358844970	675	dbSNP
rs374725704	675	dbSNP
rs1350837800	680	dbSNP
rs1439004293	680	dbSNP
rs1051676743	684	dbSNP
rs1301910458	684	dbSNP
rs997879383	685	dbSNP
rs570229461	693	dbSNP
rs1232981832	696	dbSNP
rs1176554943	698	dbSNP
rs1343935156	699	dbSNP
rs1467226425	721	dbSNP
rs1212460600	725	dbSNP
rs900331289	737	dbSNP
rs1039240429	746	dbSNP
rs941877090	750	dbSNP
rs1249735569	759	dbSNP
rs909942064	761	dbSNP
rs1048484287	762	dbSNP
rs929964352	764	dbSNP
rs1242556353	766	dbSNP
rs1251103296	767	dbSNP
rs1467972471	768	dbSNP
rs1189358372	769	dbSNP
rs117062531	780	dbSNP
rs1474429053	786	dbSNP
rs141691214	790	dbSNP
rs1407487175	791	dbSNP
rs180891560	793	dbSNP
rs1323074439	794	dbSNP
rs1327690496	804	dbSNP
rs56270258	808	dbSNP
rs371964555	815	dbSNP
rs1224566839	816	dbSNP
rs547759327	817	dbSNP
rs1227041875	819	dbSNP
rs527645534	819	dbSNP
rs980235398	824	dbSNP
rs561749471	826	dbSNP
rs968894228	828	dbSNP
rs1333805705	830	dbSNP
rs1021368609	834	dbSNP
rs572100685	837	dbSNP
rs1382742079	838	dbSNP
rs1238310468	839	dbSNP
rs988590381	840	dbSNP
rs1397287393	855	dbSNP
rs202199536	856	dbSNP
rs1458036991	861	dbSNP
rs1393769404	869	dbSNP
rs1383381934	878	dbSNP
rs1030450930	883	dbSNP
rs997194879	884	dbSNP
rs575944159	890	dbSNP
rs1462216581	892	dbSNP
rs900384476	893	dbSNP
rs1354606609	895	dbSNP
rs1228738168	903	dbSNP
rs1262462639	907	dbSNP
rs1348425815	907	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.