>DDX39B|NM_004640|3'UTR
   1 AAGACTCGCCCATTTTGGAATGTGACCGTCTGTCCTTCAGGAGAGGACACCAGGGTGGGGGTGAAGGAGACACTACTGCC
  81 CCCACCCCTGACAGCCCCCACCCCATGGCTTCCATCTTTTGCATCACCACCACTCCTGAACCCCCATTTCTGATTTGTCA
 161 GAATTTTTTTTTAACAAAACTAAAAATGAAACACATGTGTCTGTGGTATCTATAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uacagGGUGGGGGUGAGGACa 5' :|||| ||||||||| Target 5' ttgcaTCACCACCACTCCTGa 3'	119 - 139	168.00	-25.10
2	miRNA 3' uacAGGGUGGGGGUGAGGACa 5' | |::||||||| |||| Target 5' cacTACTGCCCCCACCCCTGa 3'	71 - 91	142.00	-24.30
3	miRNA 3' uacAGGG--UGGGGGUGAGGACA------- 5' |||: |||||||:|:||| Target 5' cacTCCTGAACCCCCATTTCTGATTTGTCA 3'	131 - 160	124.00	-24.59

Mutant ID	Mutant Position	Mutant Source
COSN30695702	4	COSMIC
COSN30448327	11	COSMIC
COSN18730962	21	COSMIC
COSN30177974	53	COSMIC
COSN31577469	56	COSMIC
COSN30478655	66	COSMIC
COSN31662475	98	COSMIC
COSN20459273	104	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1485567929	5	dbSNP
rs757036275	7	dbSNP
rs10819	8	dbSNP
rs754085793	9	dbSNP
rs766548140	11	dbSNP
rs1232964112	13	dbSNP
rs1308402549	18	dbSNP
rs756506378	20	dbSNP
rs1220017461	26	dbSNP
rs372496406	27	dbSNP
rs369867107	28	dbSNP
rs762220335	30	dbSNP
rs1163358168	34	dbSNP
rs896114493	38	dbSNP
rs773950892	40	dbSNP
rs72847228	45	dbSNP
rs72847227	49	dbSNP
rs547295168	50	dbSNP
rs1172575154	51	dbSNP
rs1428432778	59	dbSNP
rs1371625215	60	dbSNP
rs11264	63	dbSNP
rs1393518808	65	dbSNP
rs1179107513	75	dbSNP
rs1440410294	84	dbSNP
rs532235248	86	dbSNP
rs1245760882	89	dbSNP
rs1317297468	100	dbSNP
rs1340132888	121	dbSNP
rs1226165150	141	dbSNP
rs1273844574	146	dbSNP
rs1048885	150	dbSNP
rs1246149117	154	dbSNP
rs1219680402	162	dbSNP
rs979474614	165	dbSNP
rs1253762014	173	dbSNP
rs1386630559	173	dbSNP
rs1441538948	173	dbSNP
rs3219189	173	dbSNP
rs1453508487	196	dbSNP
rs967733074	197	dbSNP
rs1056054179	200	dbSNP
rs1291100751	201	dbSNP
rs1301506419	201	dbSNP
rs929673028	203	dbSNP
rs1021164216	208	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.