pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-3p
Sequence 58| CAUCAGAAUUCAUGGAGGCUAG |79
Evidence Experimental
Experiments 454
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31490809 22 COSMIC
COSN31579735 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs543123304 18 dbSNP
rs1450988157 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DDX39B   
Synonyms BAT1, D6S81E, UAP56
Description DExD-box helicase 39B
Transcript NM_004640   
Other Transcripts NM_080598   
Expression
Putative miRNA Targets on DDX39B
3'UTR of DDX39B
(miRNA target sites are highlighted)
>DDX39B|NM_004640|3'UTR
   1 AAGACTCGCCCATTTTGGAATGTGACCGTCTGTCCTTCAGGAGAGGACACCAGGGTGGGGGTGAAGGAGACACTACTGCC
  81 CCCACCCCTGACAGCCCCCACCCCATGGCTTCCATCTTTTGCATCACCACCACTCCTGAACCCCCATTTCTGATTTGTCA
 161 GAATTTTTTTTTAACAAAACTAAAAATGAAACACATGTGTCTGTGGTATCTATAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaUCGGAGGUACUUAAGACUAc 5'
            | || ||||   ||||||| 
Target 5' tgAACCCCCAT---TTCTGATt 3'
137 - 155 157.00 -12.40
2
miRNA  3' gaUCGGAGGUACUUAAGAC-UAc 5'
            :||:|||||   ||:|| || 
Target 5' atGGCTTCCAT--CTTTTGCATc 3'
105 - 125 116.00 -13.04
3
miRNA  3' gaUCGGAGGUACUUAAGACUac 5'
            || || |:   |||:||:  
Target 5' -aAGACT-CGCCCATTTTGGaa 3'
1 - 20 99.00 -6.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30695702 4 COSMIC
COSN30448327 11 COSMIC
COSN18730962 21 COSMIC
COSN30177974 53 COSMIC
COSN31577469 56 COSMIC
COSN30478655 66 COSMIC
COSN31662475 98 COSMIC
COSN20459273 104 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1485567929 5 dbSNP
rs757036275 7 dbSNP
rs10819 8 dbSNP
rs754085793 9 dbSNP
rs766548140 11 dbSNP
rs1232964112 13 dbSNP
rs1308402549 18 dbSNP
rs756506378 20 dbSNP
rs1220017461 26 dbSNP
rs372496406 27 dbSNP
rs369867107 28 dbSNP
rs762220335 30 dbSNP
rs1163358168 34 dbSNP
rs896114493 38 dbSNP
rs773950892 40 dbSNP
rs72847228 45 dbSNP
rs72847227 49 dbSNP
rs547295168 50 dbSNP
rs1172575154 51 dbSNP
rs1428432778 59 dbSNP
rs1371625215 60 dbSNP
rs11264 63 dbSNP
rs1393518808 65 dbSNP
rs1179107513 75 dbSNP
rs1440410294 84 dbSNP
rs532235248 86 dbSNP
rs1245760882 89 dbSNP
rs1317297468 100 dbSNP
rs1340132888 121 dbSNP
rs1226165150 141 dbSNP
rs1273844574 146 dbSNP
rs1048885 150 dbSNP
rs1246149117 154 dbSNP
rs1219680402 162 dbSNP
rs979474614 165 dbSNP
rs1253762014 173 dbSNP
rs1386630559 173 dbSNP
rs1441538948 173 dbSNP
rs3219189 173 dbSNP
rs1453508487 196 dbSNP
rs967733074 197 dbSNP
rs1056054179 200 dbSNP
rs1291100751 201 dbSNP
rs1301506419 201 dbSNP
rs929673028 203 dbSNP
rs1021164216 208 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000376177.2 | 3UTR | CCCCCACCCCAUGGCUUCCAUCUUUUGCAUCACCACCACUCCUGAACCCCCAUUUCUGAUUUGUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.958 0.02 0.800 0.1 4 Click to see details
LUSC 0.384 0.08 0.493 0.03 15 Click to see details
BLCA -0.131 0.4 0.257 0.31 6 Click to see details
BRCA 0.04 0.42 0.076 0.34 31 Click to see details
STAD 0.129 0.46 -0.500 0.33 3 Click to see details
HNSC -0.013 0.48 0.116 0.35 14 Click to see details
UCEC -0.04 0.49 -0.500 0.33 3 Click to see details
UCEC -0.04 0.49 -0.500 0.33 3 Click to see details
UCEC -0.04 0.49 -0.500 0.33 3 Click to see details
UCEC -0.04 0.49 -0.500 0.33 3 Click to see details
UCEC -0.04 0.49 -0.500 0.33 3 Click to see details
UCEC -0.04 0.49 -0.500 0.33 3 Click to see details
UCEC -0.04 0.49 -0.500 0.33 3 Click to see details
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057089 DDIT4 DNA damage inducible transcript 4 2 2
MIRT071216 FCF1 FCF1, rRNA-processing protein 2 2
MIRT226901 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235961 BACH1 BTB domain and CNC homolog 1 2 2
MIRT294569 ZNF460 zinc finger protein 460 2 4
MIRT321046 RAC1 Rac family small GTPase 1 2 4
MIRT359666 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT366451 KLHL15 kelch like family member 15 2 2
MIRT405375 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT441794 TCEAL5 transcription elongation factor A like 5 2 2
MIRT443295 TCEAL3 transcription elongation factor A like 3 2 2
MIRT455275 DDX39B DExD-box helicase 39B 2 2
MIRT458523 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT464960 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT466848 STX6 syntaxin 6 2 2
MIRT469252 RHOB ras homolog family member B 2 2
MIRT469825 RAB14 RAB14, member RAS oncogene family 2 4
MIRT470047 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471420 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT472024 NPM1 nucleophosmin 1 2 2
MIRT484156 CENPN centromere protein N 2 2
MIRT485490 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT490462 PROSER2 proline and serine rich 2 2 2
MIRT493069 MTCH1 mitochondrial carrier 1 2 2
MIRT493573 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT494919 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT500439 ZMAT3 zinc finger matrin-type 3 2 2
MIRT500931 SRPR SRP receptor alpha subunit 2 4
MIRT501551 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501809 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502415 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT506504 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT507861 CCNE2 cyclin E2 2 2
MIRT510511 YOD1 YOD1 deubiquitinase 2 6
MIRT516073 RAB42 RAB42, member RAS oncogene family 2 2
MIRT519030 KYNU kynureninase 2 6
MIRT521762 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522898 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527370 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530691 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT530867 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT531832 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT533035 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT533165 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT533464 TRIM71 tripartite motif containing 71 2 2
MIRT534331 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT539372 ADSS adenylosuccinate synthase 2 6
MIRT545951 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553283 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553532 TMEM185B transmembrane protein 185B 2 4
MIRT556480 LIPA lipase A, lysosomal acid type 2 2
MIRT556975 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT557697 GATA6 GATA binding protein 6 2 2
MIRT558901 CCDC58 coiled-coil domain containing 58 2 2
MIRT559224 BLMH bleomycin hydrolase 2 2
MIRT559827 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT563435 SLC3A2 solute carrier family 3 member 2 2 2
MIRT569270 PCDH11X protocadherin 11 X-linked 2 2
MIRT571386 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572567 AFF1 AF4/FMR2 family member 1 2 2
MIRT610400 AR androgen receptor 2 2
MIRT611058 ZNF621 zinc finger protein 621 2 2
MIRT635118 TMEM233 transmembrane protein 233 2 2
MIRT641617 DEFB118 defensin beta 118 2 2
MIRT642146 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT647295 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT648155 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT652780 TENM3 teneurin transmembrane protein 3 2 2
MIRT657356 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT658718 ELN elastin 2 2
MIRT662441 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT665302 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT699898 RUNX1 runt related transcription factor 1 2 2
MIRT700921 PDS5A PDS5 cohesin associated factor A 2 2
MIRT700992 PDE3A phosphodiesterase 3A 2 2
MIRT707397 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT711895 INSIG2 insulin induced gene 2 2 2
MIRT712072 XRCC5 X-ray repair cross complementing 5 2 2
MIRT716121 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT724470 SMAD2 SMAD family member 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2115 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-2115 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-2115-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2115-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-2115-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission