miRTarBase - #MIRT455620


—
pre-miRNA Information
pre-miRNA hsa-mir-3175   
Genomic Coordinates chr15: 92904399 - 92904475
Description Homo sapiens miR-3175 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3175
Sequence 10| CGGGGAGAGAACGCAGUGACGU |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1449291045 4 dbSNP
rs372141302 4 dbSNP
rs72647784 4 dbSNP
rs1209664292 5 dbSNP
rs563454166 6 dbSNP
rs915251599 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PABPC1L2B   
Synonyms RBM32B
Description poly(A) binding protein cytoplasmic 1 like 2B
Transcript NM_001042506   
Expression
Putative miRNA Targets on PABPC1L2B
3'UTR of PABPC1L2B
(miRNA target sites are highlighted)		 
>PABPC1L2B|NM_001042506|3'UTR
   1 AGACATCCCAGGAGCTAGCCAGCCAGCAGAGCCAAACCTTGGCTCACACCCGGTTTACAACCCCCCACCCCCAGCCCTCC
  81 CCCGCCAACCCACCAGCAGTGTATTTATTGTATTGAGAGTGCAGGTCTCTCTCTCTCTCTCTCTCCCCTTCTCTCTCCCC
 161 GCTTCCTATTTTCTCCCTCCACCTCTCCTCTCCTTCCCTTCCTCTCCCCCGCCCACCCCCACCAAGGGCGTTGTGAATAA
 241 TCTTACTAATCTGTGCCATTTGTAGGTTAAAGGCTGCCTCTTCTCCCTGTGGTTTGGTTTAAAAAGCATTTTCATTCTCT
 321 CTTTGTTTACTGCACAGGTGGTACAATTTCATGGTAGAATCATCAGAAAGGAGAAGGATATCAGATGAGGGAAGAAACAA
 401 GAGAGTAATTGCTCCCCTGGTCCTACTCCCCAGAGAGAACCACTTTTACCTTTTTGGTGTGCTGCTTTTCCAGGCTCTCT
 481 TCTCTCCCTCTCTCTCCTTTGCTCACCCCCACCCCGCCTTCCCTTTTAACACACCGTTATAGAATGGTTCATGTATGTGG
 561 TGTTTCTTAACCTGCTTTTTCAGCAACTAAAACCAAACAAAAATCAACCCATTGAACTTCTTTCCATGTTATCAACAGGC
 641 TTATGAAATGTCATCTTCAGTGCCTGCAGAGTGCTCCAGTGTATCCGTGGACCTTAACATTTCTGTAATCATTCCCGCAT
 721 TGTTGGACATTCAGGTGGTGCCTAGTTCTTTCCCTGTGTTTAAGACCAACATTGCGTGCTCTGTGCTTTGATGAGTGAAT
 801 CCTTCCTTGTCAAGCCAAATCTTTGCTAGCATCCCGGTGGTCTCCTTAACTGCGGACTTGCAAGATCCACATATAGACAT
 881 TTTAAAGACTTTTCCTGTGTGTTGCCAAAAGGCCCCCTTCATAAGCATTGTACCGATTTGCACTCGTGCCGGCCAGCGCA
 961 GCTAGTAAAGAGTATGCCCGTTTCCCCTGCATAGCCTCCTGGTCACTGTAATTGATCGTGTGTGTGCGTGCGTGCGTGTG
1041 TGCATGCGTGTGTGTGTCTTTGTGTGTGTGTCTTGGCCAGCTTGGCGGGCTGCAAAGGGTGTTTCCCTGTCCTCAGTGGT
1121 TTTGCTGCAATCAAACACTGTTTATTACCCCCTTCCCCTGTGCCCACTTCCTGTCCTTTTCCCTGTTGTCAGAAAAATAA
1201 TTCAGCGTCATTGCAGGAAAAAAATAATCACGAAGCAGACAAGTTAACAGAAGAAAATTAATGTCACCAGTAATCATTTC
1281 TGATGATTACTTATACATTCCTGAAACATTTTCATCTGTATCTGCCCTGTATTTTTCATGTGATATATATGTGAAATTAT
1361 TGTATATACTGTTTCAATATCTGCTTTTTCACACAGAAATATATATTATAGACATAGATTTATAGATATTCTTGAACTTT
1441 CATGTCATTAAATATTCTTCTAAAATA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugcAGUGACGCA-AGAGAGGGGc 5'
             || || : | ||||||||| 
Target 5' ctcTCTCTCTCTCTCTCTCCCCt 3'
 127 - 149 159.00 -16.60
2 
miRNA  3' ugcAGUGACGCAA-GAGAGGGGc 5'
             || :| | || |||||||| 
Target 5' ctcTCCTTCCCTTCCTCTCCCCc 3'
 188 - 210 159.00 -15.90
3 
miRNA  3' ugCAGU----GACGCAAGAGAGGGGc 5'
            ||:|    |||| | :||||||: 
Target 5' agGTTAAAGGCTGCCTCTTCTCCCTg 3'
 264 - 289 146.00 -20.90
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1483039148 3 dbSNP
rs1274365250 27 dbSNP
rs1216787323 41 dbSNP
rs1342983209 52 dbSNP
rs1274266453 62 dbSNP
rs1224429559 63 dbSNP
rs1347603617 64 dbSNP
rs868924580 68 dbSNP
rs868936461 74 dbSNP
rs868990576 79 dbSNP
rs1330835879 80 dbSNP
rs1412626735 123 dbSNP
rs1409274663 126 dbSNP
rs1423859511 126 dbSNP
rs1481241970 126 dbSNP
rs1180956693 175 dbSNP
rs1469969453 178 dbSNP
rs1233756243 179 dbSNP
rs1207255026 180 dbSNP
rs1441193306 181 dbSNP
rs1278071525 182 dbSNP
rs1204358305 183 dbSNP
rs1286717747 189 dbSNP
rs1227962122 202 dbSNP
rs1373801721 203 dbSNP
rs1281004030 207 dbSNP
rs1445818424 213 dbSNP
rs1358482130 216 dbSNP
rs1336865178 217 dbSNP
rs1470688789 221 dbSNP
rs1385747479 222 dbSNP
rs781959571 249 dbSNP
rs1419235759 258 dbSNP
rs1409264935 265 dbSNP
rs1179311207 274 dbSNP
rs1472121883 277 dbSNP
rs1243042387 307 dbSNP
rs1184711937 308 dbSNP
rs1462731533 309 dbSNP
rs1266256877 322 dbSNP
rs1208352179 362 dbSNP
rs1317739585 379 dbSNP
rs1286157074 393 dbSNP
rs1226367305 402 dbSNP
rs1378120511 404 dbSNP
rs1315669896 414 dbSNP
rs1454451807 415 dbSNP
rs1319294986 416 dbSNP
rs1454042200 419 dbSNP
rs1346578427 424 dbSNP
rs1161788692 426 dbSNP
rs1403987939 434 dbSNP
rs1384950510 436 dbSNP
rs1164789029 438 dbSNP
rs1446903438 441 dbSNP
rs1246337606 460 dbSNP
rs1185991546 467 dbSNP
rs1486339233 493 dbSNP
rs1244089417 507 dbSNP
rs1219586502 514 dbSNP
rs1358477564 516 dbSNP
rs1292144173 533 dbSNP
rs1248164581 536 dbSNP
rs1382270358 537 dbSNP
rs1363404821 548 dbSNP
rs1291455881 554 dbSNP
rs1365347070 559 dbSNP
rs1164603404 572 dbSNP
rs1427172828 599 dbSNP
rs1388833128 645 dbSNP
rs5981602 650 dbSNP
rs1429222125 654 dbSNP
rs376528143 658 dbSNP
rs1189697145 687 dbSNP
rs1490245684 711 dbSNP
rs1269401730 718 dbSNP
rs144572256 725 dbSNP
rs1250724511 741 dbSNP
rs782143498 743 dbSNP
rs1308764683 745 dbSNP
rs1298476297 772 dbSNP
rs1222596663 773 dbSNP
rs782700018 779 dbSNP
rs1304184184 811 dbSNP
rs1407179404 837 dbSNP
rs1369043732 840 dbSNP
rs1462883728 855 dbSNP
rs1356418690 857 dbSNP
rs1174022571 874 dbSNP
rs1480258905 875 dbSNP
rs1430204049 877 dbSNP
rs1201814904 907 dbSNP
rs1471502979 913 dbSNP
rs1249489635 914 dbSNP
rs1196316110 927 dbSNP
rs1481574344 933 dbSNP
rs1253800586 936 dbSNP
rs1202460345 946 dbSNP
rs187625726 947 dbSNP
rs1226129397 952 dbSNP
rs1334356716 959 dbSNP
rs1306728456 965 dbSNP
rs1392535504 968 dbSNP
rs1399227368 992 dbSNP
rs782474686 996 dbSNP
rs1469386329 1011 dbSNP
rs1178872380 1018 dbSNP
rs1406862950 1018 dbSNP
rs1363083161 1024 dbSNP
rs1455782531 1024 dbSNP
rs1182243721 1028 dbSNP
rs1182860035 1029 dbSNP
rs1420857780 1029 dbSNP
rs1461387870 1032 dbSNP
rs1206505124 1033 dbSNP
rs781875901 1033 dbSNP
rs1260553674 1035 dbSNP
rs1349483291 1035 dbSNP
rs1240165901 1036 dbSNP
rs1313586897 1036 dbSNP
rs1337859980 1036 dbSNP
rs1452480476 1040 dbSNP
rs1383625353 1041 dbSNP
rs1338779859 1042 dbSNP
rs1380803808 1042 dbSNP
rs1158972795 1044 dbSNP
rs1384500550 1044 dbSNP
rs1455183238 1045 dbSNP
rs1162857224 1047 dbSNP
rs1186096010 1048 dbSNP
rs1206481063 1048 dbSNP
rs1262027093 1048 dbSNP
rs1445160638 1048 dbSNP
rs190909302 1049 dbSNP
rs1289965176 1055 dbSNP
rs1245981823 1057 dbSNP
rs1360781181 1057 dbSNP
rs1317315058 1059 dbSNP
rs1325891801 1060 dbSNP
rs1319243109 1061 dbSNP
rs1384071214 1061 dbSNP
rs880002793 1061 dbSNP
rs1302290053 1071 dbSNP
rs1425272456 1072 dbSNP
rs1386977449 1073 dbSNP
rs1166593240 1077 dbSNP
rs183104677 1088 dbSNP
rs782326571 1089 dbSNP
rs782379817 1093 dbSNP
rs1373098223 1099 dbSNP
rs1194890635 1102 dbSNP
rs35495242 1105 dbSNP
rs141974740 1107 dbSNP
rs1267285675 1116 dbSNP
rs1222188059 1119 dbSNP
rs782231070 1129 dbSNP
rs1294625602 1130 dbSNP
rs782387960 1132 dbSNP
rs1338828739 1133 dbSNP
rs1270840789 1135 dbSNP
rs1229961822 1137 dbSNP
rs1343849598 1138 dbSNP
rs1282438641 1141 dbSNP
rs146386628 1142 dbSNP
rs139776847 1147 dbSNP
rs1326792072 1148 dbSNP
rs144388909 1153 dbSNP
rs1396679088 1162 dbSNP
rs1169133885 1164 dbSNP
rs1479280831 1165 dbSNP
rs145376683 1167 dbSNP
rs782039680 1198 dbSNP
rs1480981450 1201 dbSNP
rs1271412703 1205 dbSNP
rs1203117015 1215 dbSNP
rs1437742425 1217 dbSNP
rs1197595286 1218 dbSNP
rs1273861841 1218 dbSNP
rs1321450494 1223 dbSNP
rs1262773704 1225 dbSNP
rs1224291293 1229 dbSNP
rs1347170365 1232 dbSNP
rs782755099 1233 dbSNP
rs1441465096 1236 dbSNP
rs1336259460 1237 dbSNP
rs781817800 1241 dbSNP
rs1330356366 1248 dbSNP
rs1467805359 1249 dbSNP
rs1404658655 1263 dbSNP
rs782163425 1270 dbSNP
rs1470749276 1274 dbSNP
rs1427767837 1276 dbSNP
rs1470109536 1281 dbSNP
rs1233994899 1289 dbSNP
rs782133718 1292 dbSNP
rs782768536 1293 dbSNP
rs781911331 1295 dbSNP
rs782545464 1303 dbSNP
rs1281950949 1307 dbSNP
rs782586671 1311 dbSNP
rs1351082159 1325 dbSNP
rs896875673 1330 dbSNP
rs997940325 1333 dbSNP
rs1450286392 1334 dbSNP
rs1381488872 1346 dbSNP
rs1336803684 1356 dbSNP
rs1454290067 1362 dbSNP
rs1343039866 1366 dbSNP
rs1157860128 1378 dbSNP
rs1029301298 1383 dbSNP
rs889448139 1387 dbSNP
rs1006600665 1394 dbSNP
rs1033325705 1395 dbSNP
rs1409094784 1414 dbSNP
rs957340267 1424 dbSNP
rs1443325434 1428 dbSNP
rs1242675445 1433 dbSNP
rs1184266825 1438 dbSNP
rs989020532 1439 dbSNP
rs1240613117 1443 dbSNP
rs1215270716 1448 dbSNP
rs1447380100 1453 dbSNP
rs1286005895 1466 dbSNP
rs1243758593 1475 dbSNP
rs35870611 1478 dbSNP
rs1358613352 1486 dbSNP
rs1315188100 1488 dbSNP
rs1359188152 1493 dbSNP
rs1287933054 1495 dbSNP
rs781791434 1508 dbSNP
rs4892374 1510 dbSNP
rs1346225473 1512 dbSNP
rs1300424725 1516 dbSNP
rs781993553 1517 dbSNP
rs782613241 1517 dbSNP
rs192662485 1519 dbSNP
rs1385128924 1522 dbSNP
rs184708638 1527 dbSNP
rs982169042 1529 dbSNP
rs1417398692 1530 dbSNP
rs1186153298 1531 dbSNP
rs1265123362 1536 dbSNP
rs1486308519 1536 dbSNP
rs1219937710 1542 dbSNP
rs1490113546 1543 dbSNP
rs1292433059 1545 dbSNP
rs1223594269 1546 dbSNP
rs1305260275 1552 dbSNP
rs1294224805 1562 dbSNP
rs1214859465 1577 dbSNP
rs1363610931 1579 dbSNP
rs1280539199 1580 dbSNP
rs1403526868 1581 dbSNP
rs1365288937 1582 dbSNP
rs928086137 1591 dbSNP
rs1304295888 1595 dbSNP
rs1459839026 1596 dbSNP
rs1352906320 1601 dbSNP
rs1169797396 1606 dbSNP
rs1429378467 1613 dbSNP
rs1426086910 1637 dbSNP
rs781873798 1648 dbSNP
rs1479993343 1652 dbSNP
rs990803672 1666 dbSNP
rs1269246948 1675 dbSNP
rs1192915230 1679 dbSNP
rs1479608089 1683 dbSNP
rs1250323755 1686 dbSNP
rs376991245 1689 dbSNP
rs1204574057 1699 dbSNP
rs1319340183 1702 dbSNP
rs910097444 1706 dbSNP
rs1222460176 1715 dbSNP
rs1345281673 1716 dbSNP
rs1389082764 1722 dbSNP
rs1371767669 1728 dbSNP
rs941640409 1736 dbSNP
rs1462581028 1746 dbSNP
rs1402474063 1754 dbSNP
rs1174546766 1771 dbSNP
rs1469476061 1785 dbSNP
rs1429803962 1788 dbSNP
rs782417101 1789 dbSNP
rs782667330 1793 dbSNP
rs1417288047 1796 dbSNP
rs1037568345 1801 dbSNP
rs1177666750 1815 dbSNP
rs1458725268 1825 dbSNP
rs897329990 1834 dbSNP
rs1202715580 1836 dbSNP
rs1323791673 1859 dbSNP
rs782197976 1861 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 645974.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcAGUGACGCA-AGAGAGGGGc 5'
             || || : | ||||||||| 
Target 5' cucUCUCUCUCUCUCUCUCCCCu 3'
 		1 - 23
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12 PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12 PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760618. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_B PAR-CLIP data was present in SRX1760616. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_A PAR-CLIP data was present in SRX1760637. RNA binding protein: AGO2. Condition:AGO-CLIP-DU145_A PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000373521.2 | 3UTR | UCUCUCUCUCUCUCUCUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1067870
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000373521.2 | 3UTR | UCUCUCUCUCUCUCUCUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000373521.2 | 3UTR | UGCAGGUCUCUCUCUCUCUCUCUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000373521.2 | 3UTR | CUCUCUCUCUCUCUCUCUCCCCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000373521.2 | 3UTR | UCUCUCUCUCUCUCUCUCUCCCCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000373521.2 | 3UTR | CUCUCUCUCUCUCUCUCUCCCCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000373521.2 | 3UTR | CUCUCUCUCUCUCUCUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
208 hsa-miR-3175 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118211 KHSRP KH-type splicing regulatory protein 2 2
MIRT131222 ATG2A autophagy related 2A 2 2
MIRT143733 CCL22 C-C motif chemokine ligand 22 2 2
MIRT151435 ZBTB7A zinc finger and BTB domain containing 7A 2 4
MIRT191759 ZNF410 zinc finger protein 410 2 2
MIRT267302 TMEM109 transmembrane protein 109 2 2
MIRT273435 DAZAP2 DAZ associated protein 2 2 4
MIRT286061 HIC1 HIC ZBTB transcriptional repressor 1 2 2
MIRT288597 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT316768 FOXC1 forkhead box C1 2 4
MIRT331065 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 4
MIRT398528 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT443842 RGS6 regulator of G protein signaling 6 2 2
MIRT446200 GTPBP4 GTP binding protein 4 2 2
MIRT448039 SFRP1 secreted frizzled related protein 1 2 2
MIRT451946 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT453239 FTSJ3 FtsJ RNA methyltransferase homolog 3 2 2
MIRT453501 ARRB1 arrestin beta 1 2 2
MIRT453541 PRR12 proline rich 12 2 2
MIRT453953 ENTHD1 ENTH domain containing 1 2 2
MIRT454209 HLA-A major histocompatibility complex, class I, A 2 2
MIRT455501 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT455620 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 10
MIRT455631 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 10
MIRT456074 AFF2 AF4/FMR2 family member 2 2 6
MIRT456149 TTF2 transcription termination factor 2 2 2
MIRT456309 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 2 2
MIRT456444 TMEM81 transmembrane protein 81 2 2
MIRT456685 LDB1 LIM domain binding 1 2 2
MIRT457516 ZMAT5 zinc finger matrin-type 5 2 2
MIRT457599 IDS iduronate 2-sulfatase 2 2
MIRT457949 ABCC5 ATP binding cassette subfamily C member 5 2 6
MIRT458593 KCTD2 potassium channel tetramerization domain containing 2 2 2
MIRT459505 TACR3 tachykinin receptor 3 2 2
MIRT459687 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459914 HHIP hedgehog interacting protein 2 11
MIRT460610 FEM1A fem-1 homolog A 2 2
MIRT460646 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT461454 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461909 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462059 CCDC77 coiled-coil domain containing 77 2 4
MIRT462404 RBM28 RNA binding motif protein 28 2 2
MIRT462589 MYL12A myosin light chain 12A 2 2
MIRT462770 ZNF8 zinc finger protein 8 2 2
MIRT462991 ZNF740 zinc finger protein 740 2 2
MIRT463680 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464112 VPS35 VPS35, retromer complex component 2 2
MIRT464414 UNC13A unc-13 homolog A 2 6
MIRT464608 UBE4B ubiquitination factor E4B 2 2
MIRT465679 TNPO2 transportin 2 2 2
MIRT467225 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT469316 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469604 RALGAPA2 Ral GTPase activating protein catalytic alpha subunit 2 2 2
MIRT469655 RAC1 Rac family small GTPase 1 2 2
MIRT469744 RAB2B RAB2B, member RAS oncogene family 2 2
MIRT469947 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT470140 PSME3 proteasome activator subunit 3 2 2
MIRT473142 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT473287 MFRP membrane frizzled-related protein 2 2
MIRT473379 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 6
MIRT473661 MARCKSL1 MARCKS like 1 2 2
MIRT475256 IGF1R insulin like growth factor 1 receptor 2 2
MIRT475361 ICOSLG inducible T-cell costimulator ligand 2 4
MIRT475662 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT476524 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT476572 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT477624 EFNA1 ephrin A1 2 2
MIRT478125 DIRAS1 DIRAS family GTPase 1 2 2
MIRT479971 CARD10 caspase recruitment domain family member 10 2 2
MIRT480144 CALR calreticulin 2 2
MIRT480349 C5orf24 chromosome 5 open reading frame 24 2 2
MIRT480402 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480741 BNC2 basonuclin 2 2 8
MIRT481987 AMOTL2 angiomotin like 2 2 2
MIRT482650 FAM195B MAPK regulated corepressor interacting protein 1 2 4
MIRT482809 TRAF6 TNF receptor associated factor 6 2 2
MIRT482945 ZNF561 zinc finger protein 561 2 6
MIRT482987 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT483123 ONECUT3 one cut homeobox 3 2 4
MIRT483253 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483580 SLC26A9 solute carrier family 26 member 9 2 2
MIRT483704 ASPH aspartate beta-hydroxylase 2 2
MIRT483932 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484140 LRRC45 leucine rich repeat containing 45 2 4
MIRT484195 SUMO1 small ubiquitin-like modifier 1 2 4
MIRT484353 GATA6 GATA binding protein 6 2 12
MIRT484472 DDX6 DEAD-box helicase 6 2 2
MIRT484544 BARHL1 BarH like homeobox 1 2 6
MIRT484572 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT485265 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT485376 MSN moesin 2 4
MIRT485763 B4GALT5 beta-1,4-galactosyltransferase 5 2 2
MIRT485882 AGO2 argonaute 2, RISC catalytic component 2 17
MIRT486242 FASTK Fas activated serine/threonine kinase 2 2
MIRT486431 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 2 2
MIRT486569 ZNF619 zinc finger protein 619 2 2
MIRT486608 METTL6 methyltransferase like 6 2 2
MIRT487442 TFAP2B transcription factor AP-2 beta 2 4
MIRT487577 FAM83H family with sequence similarity 83 member H 2 4
MIRT487812 PER3 period circadian clock 3 2 2
MIRT487944 ISCA1 iron-sulfur cluster assembly 1 2 2
MIRT487952 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT488011 GDF5OS growth differentiation factor 5 opposite strand 2 2
MIRT488311 LDOC1 LDOC1, regulator of NFKB signaling 2 2
MIRT488639 HAND2 heart and neural crest derivatives expressed 2 2 2
MIRT488651 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT488683 NAT9 N-acetyltransferase 9 (putative) 2 2
MIRT488846 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT488970 REXO2 RNA exonuclease 2 2 2
MIRT489002 FBXO40 F-box protein 40 2 2
MIRT489038 PRPF4B pre-mRNA processing factor 4B 2 2
MIRT489167 ANKRD45 ankyrin repeat domain 45 2 2
MIRT489221 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489356 SYNGR1 synaptogyrin 1 2 4
MIRT489373 RAB11B RAB11B, member RAS oncogene family 2 6
MIRT489526 MRE11A MRE11 homolog, double strand break repair nuclease 2 14
MIRT490071 PRRT2 proline rich transmembrane protein 2 2 2
MIRT490275 ZNF562 zinc finger protein 562 2 4
MIRT490696 FSTL4 follistatin like 4 2 2
MIRT490778 PSMD3 proteasome 26S subunit, non-ATPase 3 2 2
MIRT490854 UPK2 uroplakin 2 2 2
MIRT491048 CHST12 carbohydrate sulfotransferase 12 2 2
MIRT491123 PTPRE protein tyrosine phosphatase, receptor type E 2 2
MIRT491161 LRP3 LDL receptor related protein 3 2 2
MIRT491506 CREBL2 cAMP responsive element binding protein like 2 2 2
MIRT491532 HDAC5 histone deacetylase 5 2 2
MIRT491699 PDZD4 PDZ domain containing 4 2 2
MIRT491949 VPS52 VPS52, GARP complex subunit 2 2
MIRT492226 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492278 SHISA6 shisa family member 6 2 4
MIRT492472 RASD1 ras related dexamethasone induced 1 2 4
MIRT492480 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492498 RANBP10 RAN binding protein 10 2 4
MIRT492565 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT492702 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT492916 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT493020 NACC1 nucleus accumbens associated 1 2 2
MIRT493218 MEX3A mex-3 RNA binding family member A 2 2
MIRT493313 LIMD2 LIM domain containing 2 2 2
MIRT493410 KDM6B lysine demethylase 6B 2 2
MIRT493451 ITFG3 family with sequence similarity 234 member A 2 2
MIRT494028 DUSP7 dual specificity phosphatase 7 2 4
MIRT494329 CASKIN1 CASK interacting protein 1 2 2
MIRT496564 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT496771 ADAMTS14 ADAM metallopeptidase with thrombospondin type 1 motif 14 2 2
MIRT496973 RPS6KA2 ribosomal protein S6 kinase A2 2 2
MIRT497038 DYRK1B dual specificity tyrosine phosphorylation regulated kinase 1B 2 2
MIRT498913 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT499006 CCDC50 coiled-coil domain containing 50 2 2
MIRT499637 CREB3L2 cAMP responsive element binding protein 3 like 2 2 2
MIRT501700 PCGF3 polycomb group ring finger 3 2 6
MIRT502230 HOXC6 homeobox C6 2 2
MIRT502655 CTC1 CST telomere replication complex component 1 2 13
MIRT506246 PER1 period circadian clock 1 2 8
MIRT506430 NAGK N-acetylglucosamine kinase 2 6
MIRT507336 FAM168A family with sequence similarity 168 member A 2 2
MIRT507781 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT510062 C12orf49 chromosome 12 open reading frame 49 2 4
MIRT511935 FAM127B retrotransposon Gag like 8A 2 2
MIRT513037 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT513518 YIPF4 Yip1 domain family member 4 2 6
MIRT522612 MAP7D1 MAP7 domain containing 1 2 4
MIRT527162 ADRA2B adrenoceptor alpha 2B 2 2
MIRT535350 PFN1 profilin 1 2 2
MIRT536734 IER5 immediate early response 5 2 4
MIRT538505 CLIP1 CAP-Gly domain containing linker protein 1 2 2
MIRT544643 PHF8 PHD finger protein 8 2 4
MIRT544856 MYH2 myosin heavy chain 2 2 4
MIRT568898 ATP6V1B1 ATPase H+ transporting V1 subunit B1 2 2
MIRT568949 RUNX3 runt related transcription factor 3 2 2
MIRT568971 CACNA1C calcium voltage-gated channel subunit alpha1 C 2 2
MIRT569037 IL21R interleukin 21 receptor 2 2
MIRT569310 CC2D1B coiled-coil and C2 domain containing 1B 2 2
MIRT569721 GPR173 G protein-coupled receptor 173 2 2
MIRT569765 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT569857 KRT80 keratin 80 2 2
MIRT569867 KLK10 kallikrein related peptidase 10 2 2
MIRT569914 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570060 CPNE2 copine 2 2 2
MIRT570307 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT570982 RGS19 regulator of G protein signaling 19 2 2
MIRT571025 CLSTN1 calsyntenin 1 2 2
MIRT573215 NAT10 N-acetyltransferase 10 2 2
MIRT574633 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT574690 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT575732 Hhip Hedgehog-interacting protein 2 7
MIRT575837 Ago2 argonaute RISC catalytic subunit 2 2 10
MIRT631303 CBS cystathionine-beta-synthase 2 2
MIRT647750 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT648323 PLIN1 perilipin 1 2 2
MIRT649339 HEXA hexosaminidase subunit alpha 2 2
MIRT649994 MSI1 musashi RNA binding protein 1 2 2
MIRT661786 NLRC3 NLR family CARD domain containing 3 2 2
MIRT665992 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT667177 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT667386 MOB1B MOB kinase activator 1B 2 2
MIRT680929 EVC EvC ciliary complex subunit 1 2 2
MIRT691870 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT693258 HBS1L HBS1 like translational GTPase 2 2
MIRT693490 MOB3A MOB kinase activator 3A 2 2
MIRT696099 SETD1A SET domain containing 1A 2 2
MIRT697955 TSPYL1 TSPY like 1 2 2
MIRT699481 SLC10A6 solute carrier family 10 member 6 2 2
MIRT708274 ZNF101 zinc finger protein 101 2 2
MIRT712147 TAOK1 TAO kinase 1 2 2
MIRT717122 SOWAHA sosondowah ankyrin repeat domain family member A 2 2
MIRT717643 HLX H2.0 like homeobox 2 2
MIRT755336 DCAF1 DDB1 and CUL4 associated factor 1 6 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-3175 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-3175 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PATU8988)
hsa-miR-3175 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3175 Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3175 Temozolomide 5394 NSC362856 approved sensitive High Glioblastoma cell line (U251)
hsa-mir-3175 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-3175 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-3175 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-3175 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-3175 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-3175 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-3175 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3175 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-3175 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-3175 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-3175 Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3175 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3175 Neoadjuvant chemotherapy resistant tissue (breast cancer)

Error report submission