miRTarBase - #MIRT455628


—
pre-miRNA Information
pre-miRNA hsa-mir-3179-1   
Genomic Coordinates chr16: 14901508 - 14901591
Description Homo sapiens miR-3179-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-2   
Genomic Coordinates chr16: 16300159 - 16300242
Description Homo sapiens miR-3179-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-3   
Genomic Coordinates chr16: 18411894 - 18411977
Description Homo sapiens miR-3179-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-4   
Genomic Coordinates chr16: 18494493 - 18494576
Description Homo sapiens miR-3179-4 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-3179
Sequence 52| AGAAGGGGUGAAAUUUAAACGU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1351100204 1 dbSNP
rs1398613616 4 dbSNP
rs1340262765 20 dbSNP
rs1229893475 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PABPC1L2B   
Synonyms RBM32B
Description poly(A) binding protein cytoplasmic 1 like 2B
Transcript NM_001042506   
Expression
Putative miRNA Targets on PABPC1L2B
3'UTR of PABPC1L2B
(miRNA target sites are highlighted)		 
>PABPC1L2B|NM_001042506|3'UTR
   1 AGACATCCCAGGAGCTAGCCAGCCAGCAGAGCCAAACCTTGGCTCACACCCGGTTTACAACCCCCCACCCCCAGCCCTCC
  81 CCCGCCAACCCACCAGCAGTGTATTTATTGTATTGAGAGTGCAGGTCTCTCTCTCTCTCTCTCTCCCCTTCTCTCTCCCC
 161 GCTTCCTATTTTCTCCCTCCACCTCTCCTCTCCTTCCCTTCCTCTCCCCCGCCCACCCCCACCAAGGGCGTTGTGAATAA
 241 TCTTACTAATCTGTGCCATTTGTAGGTTAAAGGCTGCCTCTTCTCCCTGTGGTTTGGTTTAAAAAGCATTTTCATTCTCT
 321 CTTTGTTTACTGCACAGGTGGTACAATTTCATGGTAGAATCATCAGAAAGGAGAAGGATATCAGATGAGGGAAGAAACAA
 401 GAGAGTAATTGCTCCCCTGGTCCTACTCCCCAGAGAGAACCACTTTTACCTTTTTGGTGTGCTGCTTTTCCAGGCTCTCT
 481 TCTCTCCCTCTCTCTCCTTTGCTCACCCCCACCCCGCCTTCCCTTTTAACACACCGTTATAGAATGGTTCATGTATGTGG
 561 TGTTTCTTAACCTGCTTTTTCAGCAACTAAAACCAAACAAAAATCAACCCATTGAACTTCTTTCCATGTTATCAACAGGC
 641 TTATGAAATGTCATCTTCAGTGCCTGCAGAGTGCTCCAGTGTATCCGTGGACCTTAACATTTCTGTAATCATTCCCGCAT
 721 TGTTGGACATTCAGGTGGTGCCTAGTTCTTTCCCTGTGTTTAAGACCAACATTGCGTGCTCTGTGCTTTGATGAGTGAAT
 801 CCTTCCTTGTCAAGCCAAATCTTTGCTAGCATCCCGGTGGTCTCCTTAACTGCGGACTTGCAAGATCCACATATAGACAT
 881 TTTAAAGACTTTTCCTGTGTGTTGCCAAAAGGCCCCCTTCATAAGCATTGTACCGATTTGCACTCGTGCCGGCCAGCGCA
 961 GCTAGTAAAGAGTATGCCCGTTTCCCCTGCATAGCCTCCTGGTCACTGTAATTGATCGTGTGTGTGCGTGCGTGCGTGTG
1041 TGCATGCGTGTGTGTGTCTTTGTGTGTGTGTCTTGGCCAGCTTGGCGGGCTGCAAAGGGTGTTTCCCTGTCCTCAGTGGT
1121 TTTGCTGCAATCAAACACTGTTTATTACCCCCTTCCCCTGTGCCCACTTCCTGTCCTTTTCCCTGTTGTCAGAAAAATAA
1201 TTCAGCGTCATTGCAGGAAAAAAATAATCACGAAGCAGACAAGTTAACAGAAGAAAATTAATGTCACCAGTAATCATTTC
1281 TGATGATTACTTATACATTCCTGAAACATTTTCATCTGTATCTGCCCTGTATTTTTCATGTGATATATATGTGAAATTAT
1361 TGTATATACTGTTTCAATATCTGCTTTTTCACACAGAAATATATATTATAGACATAGATTTATAGATATTCTTGAACTTT
1441 CATGTCATTAAATATTCTTCTAAAATA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugCAAAUUUAAAGUGGGGAAGa 5'
            ||||  ||| | ||||||| 
Target 5' ctGTTT--ATTAC-CCCCTTCc 3'
 1138 - 1156 159.00 -13.90
2 
miRNA  3' ugcaaauuuAAAGUGGGGAAGa 5'
                   | || ||||||| 
Target 5' ctctctctcTCTCTCCCCTTCt 3'
 131 - 152 149.00 -14.30
3 
miRNA  3' ugCAA--AUUUAAAGUGGGGAAGa 5'
            |||   |||   | ||||||| 
Target 5' gtGTTGCCAAAAGGC-CCCCTTCa 3'
 899 - 921 145.00 -12.90
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1483039148 3 dbSNP
rs1274365250 27 dbSNP
rs1216787323 41 dbSNP
rs1342983209 52 dbSNP
rs1274266453 62 dbSNP
rs1224429559 63 dbSNP
rs1347603617 64 dbSNP
rs868924580 68 dbSNP
rs868936461 74 dbSNP
rs868990576 79 dbSNP
rs1330835879 80 dbSNP
rs1412626735 123 dbSNP
rs1409274663 126 dbSNP
rs1423859511 126 dbSNP
rs1481241970 126 dbSNP
rs1180956693 175 dbSNP
rs1469969453 178 dbSNP
rs1233756243 179 dbSNP
rs1207255026 180 dbSNP
rs1441193306 181 dbSNP
rs1278071525 182 dbSNP
rs1204358305 183 dbSNP
rs1286717747 189 dbSNP
rs1227962122 202 dbSNP
rs1373801721 203 dbSNP
rs1281004030 207 dbSNP
rs1445818424 213 dbSNP
rs1358482130 216 dbSNP
rs1336865178 217 dbSNP
rs1470688789 221 dbSNP
rs1385747479 222 dbSNP
rs781959571 249 dbSNP
rs1419235759 258 dbSNP
rs1409264935 265 dbSNP
rs1179311207 274 dbSNP
rs1472121883 277 dbSNP
rs1243042387 307 dbSNP
rs1184711937 308 dbSNP
rs1462731533 309 dbSNP
rs1266256877 322 dbSNP
rs1208352179 362 dbSNP
rs1317739585 379 dbSNP
rs1286157074 393 dbSNP
rs1226367305 402 dbSNP
rs1378120511 404 dbSNP
rs1315669896 414 dbSNP
rs1454451807 415 dbSNP
rs1319294986 416 dbSNP
rs1454042200 419 dbSNP
rs1346578427 424 dbSNP
rs1161788692 426 dbSNP
rs1403987939 434 dbSNP
rs1384950510 436 dbSNP
rs1164789029 438 dbSNP
rs1446903438 441 dbSNP
rs1246337606 460 dbSNP
rs1185991546 467 dbSNP
rs1486339233 493 dbSNP
rs1244089417 507 dbSNP
rs1219586502 514 dbSNP
rs1358477564 516 dbSNP
rs1292144173 533 dbSNP
rs1248164581 536 dbSNP
rs1382270358 537 dbSNP
rs1363404821 548 dbSNP
rs1291455881 554 dbSNP
rs1365347070 559 dbSNP
rs1164603404 572 dbSNP
rs1427172828 599 dbSNP
rs1388833128 645 dbSNP
rs5981602 650 dbSNP
rs1429222125 654 dbSNP
rs376528143 658 dbSNP
rs1189697145 687 dbSNP
rs1490245684 711 dbSNP
rs1269401730 718 dbSNP
rs144572256 725 dbSNP
rs1250724511 741 dbSNP
rs782143498 743 dbSNP
rs1308764683 745 dbSNP
rs1298476297 772 dbSNP
rs1222596663 773 dbSNP
rs782700018 779 dbSNP
rs1304184184 811 dbSNP
rs1407179404 837 dbSNP
rs1369043732 840 dbSNP
rs1462883728 855 dbSNP
rs1356418690 857 dbSNP
rs1174022571 874 dbSNP
rs1480258905 875 dbSNP
rs1430204049 877 dbSNP
rs1201814904 907 dbSNP
rs1471502979 913 dbSNP
rs1249489635 914 dbSNP
rs1196316110 927 dbSNP
rs1481574344 933 dbSNP
rs1253800586 936 dbSNP
rs1202460345 946 dbSNP
rs187625726 947 dbSNP
rs1226129397 952 dbSNP
rs1334356716 959 dbSNP
rs1306728456 965 dbSNP
rs1392535504 968 dbSNP
rs1399227368 992 dbSNP
rs782474686 996 dbSNP
rs1469386329 1011 dbSNP
rs1178872380 1018 dbSNP
rs1406862950 1018 dbSNP
rs1363083161 1024 dbSNP
rs1455782531 1024 dbSNP
rs1182243721 1028 dbSNP
rs1182860035 1029 dbSNP
rs1420857780 1029 dbSNP
rs1461387870 1032 dbSNP
rs1206505124 1033 dbSNP
rs781875901 1033 dbSNP
rs1260553674 1035 dbSNP
rs1349483291 1035 dbSNP
rs1240165901 1036 dbSNP
rs1313586897 1036 dbSNP
rs1337859980 1036 dbSNP
rs1452480476 1040 dbSNP
rs1383625353 1041 dbSNP
rs1338779859 1042 dbSNP
rs1380803808 1042 dbSNP
rs1158972795 1044 dbSNP
rs1384500550 1044 dbSNP
rs1455183238 1045 dbSNP
rs1162857224 1047 dbSNP
rs1186096010 1048 dbSNP
rs1206481063 1048 dbSNP
rs1262027093 1048 dbSNP
rs1445160638 1048 dbSNP
rs190909302 1049 dbSNP
rs1289965176 1055 dbSNP
rs1245981823 1057 dbSNP
rs1360781181 1057 dbSNP
rs1317315058 1059 dbSNP
rs1325891801 1060 dbSNP
rs1319243109 1061 dbSNP
rs1384071214 1061 dbSNP
rs880002793 1061 dbSNP
rs1302290053 1071 dbSNP
rs1425272456 1072 dbSNP
rs1386977449 1073 dbSNP
rs1166593240 1077 dbSNP
rs183104677 1088 dbSNP
rs782326571 1089 dbSNP
rs782379817 1093 dbSNP
rs1373098223 1099 dbSNP
rs1194890635 1102 dbSNP
rs35495242 1105 dbSNP
rs141974740 1107 dbSNP
rs1267285675 1116 dbSNP
rs1222188059 1119 dbSNP
rs782231070 1129 dbSNP
rs1294625602 1130 dbSNP
rs782387960 1132 dbSNP
rs1338828739 1133 dbSNP
rs1270840789 1135 dbSNP
rs1229961822 1137 dbSNP
rs1343849598 1138 dbSNP
rs1282438641 1141 dbSNP
rs146386628 1142 dbSNP
rs139776847 1147 dbSNP
rs1326792072 1148 dbSNP
rs144388909 1153 dbSNP
rs1396679088 1162 dbSNP
rs1169133885 1164 dbSNP
rs1479280831 1165 dbSNP
rs145376683 1167 dbSNP
rs782039680 1198 dbSNP
rs1480981450 1201 dbSNP
rs1271412703 1205 dbSNP
rs1203117015 1215 dbSNP
rs1437742425 1217 dbSNP
rs1197595286 1218 dbSNP
rs1273861841 1218 dbSNP
rs1321450494 1223 dbSNP
rs1262773704 1225 dbSNP
rs1224291293 1229 dbSNP
rs1347170365 1232 dbSNP
rs782755099 1233 dbSNP
rs1441465096 1236 dbSNP
rs1336259460 1237 dbSNP
rs781817800 1241 dbSNP
rs1330356366 1248 dbSNP
rs1467805359 1249 dbSNP
rs1404658655 1263 dbSNP
rs782163425 1270 dbSNP
rs1470749276 1274 dbSNP
rs1427767837 1276 dbSNP
rs1470109536 1281 dbSNP
rs1233994899 1289 dbSNP
rs782133718 1292 dbSNP
rs782768536 1293 dbSNP
rs781911331 1295 dbSNP
rs782545464 1303 dbSNP
rs1281950949 1307 dbSNP
rs782586671 1311 dbSNP
rs1351082159 1325 dbSNP
rs896875673 1330 dbSNP
rs997940325 1333 dbSNP
rs1450286392 1334 dbSNP
rs1381488872 1346 dbSNP
rs1336803684 1356 dbSNP
rs1454290067 1362 dbSNP
rs1343039866 1366 dbSNP
rs1157860128 1378 dbSNP
rs1029301298 1383 dbSNP
rs889448139 1387 dbSNP
rs1006600665 1394 dbSNP
rs1033325705 1395 dbSNP
rs1409094784 1414 dbSNP
rs957340267 1424 dbSNP
rs1443325434 1428 dbSNP
rs1242675445 1433 dbSNP
rs1184266825 1438 dbSNP
rs989020532 1439 dbSNP
rs1240613117 1443 dbSNP
rs1215270716 1448 dbSNP
rs1447380100 1453 dbSNP
rs1286005895 1466 dbSNP
rs1243758593 1475 dbSNP
rs35870611 1478 dbSNP
rs1358613352 1486 dbSNP
rs1315188100 1488 dbSNP
rs1359188152 1493 dbSNP
rs1287933054 1495 dbSNP
rs781791434 1508 dbSNP
rs4892374 1510 dbSNP
rs1346225473 1512 dbSNP
rs1300424725 1516 dbSNP
rs781993553 1517 dbSNP
rs782613241 1517 dbSNP
rs192662485 1519 dbSNP
rs1385128924 1522 dbSNP
rs184708638 1527 dbSNP
rs982169042 1529 dbSNP
rs1417398692 1530 dbSNP
rs1186153298 1531 dbSNP
rs1265123362 1536 dbSNP
rs1486308519 1536 dbSNP
rs1219937710 1542 dbSNP
rs1490113546 1543 dbSNP
rs1292433059 1545 dbSNP
rs1223594269 1546 dbSNP
rs1305260275 1552 dbSNP
rs1294224805 1562 dbSNP
rs1214859465 1577 dbSNP
rs1363610931 1579 dbSNP
rs1280539199 1580 dbSNP
rs1403526868 1581 dbSNP
rs1365288937 1582 dbSNP
rs928086137 1591 dbSNP
rs1304295888 1595 dbSNP
rs1459839026 1596 dbSNP
rs1352906320 1601 dbSNP
rs1169797396 1606 dbSNP
rs1429378467 1613 dbSNP
rs1426086910 1637 dbSNP
rs781873798 1648 dbSNP
rs1479993343 1652 dbSNP
rs990803672 1666 dbSNP
rs1269246948 1675 dbSNP
rs1192915230 1679 dbSNP
rs1479608089 1683 dbSNP
rs1250323755 1686 dbSNP
rs376991245 1689 dbSNP
rs1204574057 1699 dbSNP
rs1319340183 1702 dbSNP
rs910097444 1706 dbSNP
rs1222460176 1715 dbSNP
rs1345281673 1716 dbSNP
rs1389082764 1722 dbSNP
rs1371767669 1728 dbSNP
rs941640409 1736 dbSNP
rs1462581028 1746 dbSNP
rs1402474063 1754 dbSNP
rs1174546766 1771 dbSNP
rs1469476061 1785 dbSNP
rs1429803962 1788 dbSNP
rs782417101 1789 dbSNP
rs782667330 1793 dbSNP
rs1417288047 1796 dbSNP
rs1037568345 1801 dbSNP
rs1177666750 1815 dbSNP
rs1458725268 1825 dbSNP
rs897329990 1834 dbSNP
rs1202715580 1836 dbSNP
rs1323791673 1859 dbSNP
rs782197976 1861 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 645974.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcaaauuuAAAGUGGGGAAGa 5'
                   | || ||||||| 
Target 5' cucucucucUCUCUCCCCUUCu 3'
 		5 - 26
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12 PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12 PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760618. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_B PAR-CLIP data was present in SRX1760616. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_A PAR-CLIP data was present in SRX1760637. RNA binding protein: AGO2. Condition:AGO-CLIP-DU145_A PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM4903829
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_a
Location of target site NM_001042506 | 3UTR | GGCCCCCUUCAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903830
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_b
Location of target site NM_001042506 | 3UTR | GGCCCCCUUCAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000373521.2 | 3UTR | UCUCUCUCUCUCUCUCUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1067870
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000373521.2 | 3UTR | UCUCUCUCUCUCUCUCUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000373521.2 | 3UTR | UGCAGGUCUCUCUCUCUCUCUCUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000373521.2 | 3UTR | CUCUCUCUCUCUCUCUCUCCCCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000373521.2 | 3UTR | UCUCUCUCUCUCUCUCUCUCCCCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000373521.2 | 3UTR | CUCUCUCUCUCUCUCUCUCCCCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000373521.2 | 3UTR | CUCUCUCUCUCUCUCUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
133 hsa-miR-3179 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102087 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT110061 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 6
MIRT112198 BTG2 BTG anti-proliferation factor 2 2 2
MIRT117668 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT146657 MINK1 misshapen like kinase 1 2 2
MIRT175505 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT180535 TXNIP thioredoxin interacting protein 2 2
MIRT190624 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190650 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT366902 NONO non-POU domain containing octamer binding 2 2
MIRT443554 ZFP3 ZFP3 zinc finger protein 2 2
MIRT445953 MLLT11 MLLT11, transcription factor 7 cofactor 2 2
MIRT446042 HMCN1 hemicentin 1 2 2
MIRT447968 MSH6 mutS homolog 6 2 2
MIRT448634 ONECUT1 one cut homeobox 1 2 2
MIRT449316 MRO maestro 2 2
MIRT451380 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451547 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451807 CDCA3 cell division cycle associated 3 2 4
MIRT451916 ILK integrin linked kinase 2 2
MIRT451938 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452189 KIAA1456 KIAA1456 2 2
MIRT452498 HMGXB3 HMG-box containing 3 2 2
MIRT452548 ZNF467 zinc finger protein 467 2 2
MIRT453844 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT454515 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT455363 KDM5C lysine demethylase 5C 2 2
MIRT455455 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455628 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 10
MIRT455639 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 10
MIRT455690 GLO1 glyoxalase I 2 2
MIRT456300 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT456784 MTHFSD methenyltetrahydrofolate synthetase domain containing 2 2
MIRT456819 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457566 ZNF34 zinc finger protein 34 2 2
MIRT457604 IDS iduronate 2-sulfatase 2 2
MIRT458236 NXPH3 neurexophilin 3 2 2
MIRT458313 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458350 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458670 GPR35 G protein-coupled receptor 35 2 2
MIRT459675 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT461126 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461918 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462301 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT463520 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT464378 URM1 ubiquitin related modifier 1 2 2
MIRT464614 UBE4B ubiquitination factor E4B 2 2
MIRT464711 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465520 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465974 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466058 TMEM189 transmembrane protein 189 2 2
MIRT466548 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT466647 TAGLN2 transgelin 2 2 2
MIRT467357 SP2 Sp2 transcription factor 2 2
MIRT468744 SDC2 syndecan 2 2 2
MIRT470244 PRRC2A proline rich coiled-coil 2A 2 2
MIRT471426 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471732 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472190 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472450 NAV2 neuron navigator 2 2 6
MIRT474563 KLHDC3 kelch domain containing 3 2 2
MIRT474936 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475165 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475399 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT475426 ICK intestinal cell kinase 2 2
MIRT477090 FAM168A family with sequence similarity 168 member A 2 2
MIRT478458 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478953 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480096 CALR calreticulin 2 2
MIRT481924 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT483217 APOA1 apolipoprotein A1 2 6
MIRT483882 TGIF1 TGFB induced factor homeobox 1 2 2
MIRT483923 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 2
MIRT483942 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484209 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484512 SYT7 synaptotagmin 7 2 2
MIRT484709 RNF11 ring finger protein 11 2 2
MIRT485356 MYO1C myosin IC 2 4
MIRT485615 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT486584 ZNF619 zinc finger protein 619 2 2
MIRT487013 C2orf82 chromosome 2 open reading frame 82 2 2
MIRT487621 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487801 GPR20 G protein-coupled receptor 20 2 4
MIRT488134 GPR107 G protein-coupled receptor 107 2 2
MIRT488773 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT488854 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489783 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490102 FN3K fructosamine 3 kinase 2 2
MIRT490389 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490434 MYL9 myosin light chain 9 2 2
MIRT490451 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490880 OSBP oxysterol binding protein 2 2
MIRT491037 ALPK3 alpha kinase 3 2 2
MIRT491250 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491748 SEMA3F semaphorin 3F 2 2
MIRT492235 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492490 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492505 RANBP10 RAN binding protein 10 2 4
MIRT492773 PDGFB platelet derived growth factor subunit B 2 2
MIRT492922 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT493459 ITFG3 family with sequence similarity 234 member A 2 2
MIRT493654 HDLBP high density lipoprotein binding protein 2 2
MIRT494011 DUSP9 dual specificity phosphatase 9 2 2
MIRT499412 PLCG2 phospholipase C gamma 2 2 4
MIRT499552 C15orf43 telomere repeat binding bouquet formation protein 2 2 2
MIRT501836 NCOA2 nuclear receptor coactivator 2 2 2
MIRT501950 MAT2A methionine adenosyltransferase 2A 2 10
MIRT504066 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT504509 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT508466 HOXB6 homeobox B6 2 4
MIRT512373 CPM carboxypeptidase M 2 2
MIRT513578 EVX1 even-skipped homeobox 1 2 2
MIRT517763 ZNF366 zinc finger protein 366 2 4
MIRT519773 ZNF354B zinc finger protein 354B 2 8
MIRT523568 GGCX gamma-glutamyl carboxylase 2 4
MIRT532802 CLDN11 claudin 11 2 2
MIRT544299 TSPYL1 TSPY like 1 2 2
MIRT544862 MYH2 myosin heavy chain 2 2 4
MIRT556731 KLHL15 kelch like family member 15 2 4
MIRT564347 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568924 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT569012 CXorf36 chromosome X open reading frame 36 2 2
MIRT569256 FAM129B family with sequence similarity 129 member B 2 2
MIRT569591 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT569779 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT570034 FAM228A family with sequence similarity 228 member A 2 2
MIRT573803 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574190 ZNF264 zinc finger protein 264 2 2
MIRT576153 Hmox1 heme oxygenase 1 2 2
MIRT611311 CA8 carbonic anhydrase 8 2 4
MIRT673429 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT674976 SH3BP2 SH3 domain binding protein 2 2 2
MIRT692712 MEAF6 MYST/Esa1 associated factor 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3179 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission