>PABPC1L2A|NM_001012977|3'UTR
   1 AGACATCCCAGGAGCTAGCCAGCCAGCAGAGCCAAACCTTGGCTCACACCCGGTTTACAACCCCCCACCCCCAGCCCTCC
  81 CCCGCCAACCCACCAGCAGTGTATTTATTGTATTGAGAGTGCAGGTCTCTCTCTCTCTCTCTCTCCCCTTCTCTCTCCCC
 161 GCTTCCTATTTTCTCCCTCCACCTCTCCTCTCCTTCCCTTCCTCTCCCCCGCCCACCCCCACCAAGGGCGTTGTGAATAA
 241 TCTTACTAATCTGTGCCATTTGTAGGTTAAAGGCTGCCTCTTCTCCCTGTGGTTTGATTTAAAAAGCATTTTCATTCTCT
 321 CTTTGTTTACTGCACAGGTGGTACAATTTCATGGTAGAATCATCAGAAAGGAGAAGGATATCAGATGAGGGAAGAAACAA
 401 GAGAGTAATTGCTCCCCTGGTCCTACTCCCCAGAGAGAACCACTTTTACCTTTTTGGTGTGCTGCTTTTCCAGGCTCTCT
 481 TCTCTCCCTCTCTCTCCTTTGCTCACCCCCACCCCGCCTTCCCTTTTAACACACCGTTATAGAATGGTTCATGTATGTGG
 561 TGTTTCTTAACCTGCTTTTTCAGCAACTAAAACCAAACAAAAATCAACCCATTGAACTTCTTTCCATGTTATCAACAGGC
 641 TTATGAAACGTCATCTTCAGTGCCTGCAGAGTGCTCCAGTGTATCCGTGGACCTTAACATTTCTGTAATCATTCCCGCAT
 721 TGTTGGACATTCAGGTGGTGCCTAGTTCTTTCCCTGTGTTTAAGACCAACATTGCGTGCTCTGTGCTTTGATGAGTGAAT
 801 CCTTCCTTGTCAAGCCAAATCTTTGCTAGCATCCCGGTGGTCTCCTTAACTGCGGACTTGCAAGATCCACATATAGACAT
 881 TTTAAAGACTTTTCCTGTGTGTTGCCAAAAGGCCCCCTTCATAAGCATTGTACCGATTTGCACTCGTGCCGGCCAGCGCA
 961 GCTAGTAAAGAGTATGCCCGTTTCCCCTGCATAGTCTCCTGGTCACTGTAATTGATCGTGTGTGTGCGTGCGTGTGTGTG
1041 TGTGTGTGTGTGTGTGTGTGTCTTGGCCAGCTTGGCGGGCTACAAAGGGTGTTTCGCTGTCCTCGGTAGTTTTGCTGGAA
1121 ACAAACACTGCTTATGACCCCATTCCCCTGTGCCCTCTTCCTGTCCTTTTCCCTGTTGTCAGAAAAGTAATTCAGCGTCA
1201 TTGCAAGAAAAAAAAATCACAAAGCAGACAAGTTACCAGAAGAAAATTAAAGTCACCAGTAATCATTTCTGATGATTACA
1281 CACACATTCCAGAAACATTTTCATGCACACCTCTCTGATATTTTCTAGAACTACCTGAAACATTTTTGTCTGTAGGTCTA
1361 GTTTTTTTCTTATGCATATATCATATATGTATATTATGATGTACAGACTGTTTTTATATCTGCTTTTCACACATACATGT
1441 GTGTGT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugcaaauuuAAAGUGGGGAAGa 5' | || ||||||| Target 5' ctctctctcTCTCTCCCCTTCt 3'	131 - 152	149.00	-14.30
2	miRNA 3' ugCAA--AUUUAAAGUGGGGAAGa 5' ||| ||| | ||||||| Target 5' gtGTTGCCAAAAGGC-CCCCTTCa 3'	899 - 921	145.00	-12.90
3	miRNA 3' ugCAAAUUUAAAGUGGGGAAGa 5' | ||||| ::||:|||| Target 5' taGGTTAAAGGCTGCCTCTTCt 3'	263 - 284	144.00	-12.90

Mutant ID	Mutant Position	Mutant Source
rs1351113740	67	dbSNP
rs1424969533	137	dbSNP
rs1302124568	146	dbSNP
rs1343455249	146	dbSNP
rs1401578227	147	dbSNP
rs1270724687	215	dbSNP
rs1361121847	221	dbSNP
rs74722665	297	dbSNP
rs1292185332	307	dbSNP
rs1360226196	321	dbSNP
rs1222072486	378	dbSNP
rs1289812029	392	dbSNP
rs1489487018	395	dbSNP
rs1194766386	401	dbSNP
rs1242048677	414	dbSNP
rs782581819	415	dbSNP
rs1184096784	418	dbSNP
rs1415394325	418	dbSNP
rs1424710665	423	dbSNP
rs1162573335	425	dbSNP
rs1363280989	428	dbSNP
rs1421306412	437	dbSNP
rs1318653006	440	dbSNP
rs1344367541	448	dbSNP
rs1428605345	466	dbSNP
rs1285844869	474	dbSNP
rs1383657429	492	dbSNP
rs1245271266	506	dbSNP
rs1313203315	513	dbSNP
rs1356039210	515	dbSNP
rs1205937693	534	dbSNP
rs1212911654	535	dbSNP
rs1244251621	536	dbSNP
rs1444743033	538	dbSNP
rs1182384403	547	dbSNP
rs1441221886	553	dbSNP
rs1158761618	557	dbSNP
rs1407026518	558	dbSNP
rs1398697169	571	dbSNP
rs1336114152	573	dbSNP
rs1406652899	577	dbSNP
rs1452011676	598	dbSNP
rs1334873612	610	dbSNP
rs1379190883	624	dbSNP
rs1240091217	631	dbSNP
rs782479284	644	dbSNP
rs76958364	657	dbSNP
rs1221247817	663	dbSNP
rs1264323124	691	dbSNP
rs1461209366	710	dbSNP
rs4892534	724	dbSNP
rs1439007941	735	dbSNP
rs1182113498	740	dbSNP
rs1362807348	741	dbSNP
rs1468420063	742	dbSNP
rs1174043533	744	dbSNP
rs1429728653	745	dbSNP
rs1469280103	748	dbSNP
rs1174155368	751	dbSNP
rs1402598829	771	dbSNP
rs1391999863	774	dbSNP
rs1328463561	775	dbSNP
rs1334149993	777	dbSNP
rs1439062912	778	dbSNP
rs1284407486	779	dbSNP
rs1323245494	834	dbSNP
rs1222261723	835	dbSNP
rs1260504672	836	dbSNP
rs1340885614	867	dbSNP
rs1195810199	871	dbSNP
rs1249384614	874	dbSNP
rs1435785611	879	dbSNP
rs1201118222	888	dbSNP
rs782635124	897	dbSNP
rs1269395353	904	dbSNP
rs1479970477	906	dbSNP
rs1197229613	912	dbSNP
rs1374677992	915	dbSNP
rs1462577115	917	dbSNP
rs1167342459	921	dbSNP
rs1394420350	928	dbSNP
rs1407355151	943	dbSNP
rs192934034	946	dbSNP
rs1345307477	947	dbSNP
rs1403435887	949	dbSNP
rs1280662456	950	dbSNP
rs1327461664	957	dbSNP
rs1227334472	973	dbSNP
rs3117680	995	dbSNP
rs1336855993	1011	dbSNP
rs782809577	1027	dbSNP
rs1224303535	1028	dbSNP
rs141350054	1030	dbSNP
rs868951192	1031	dbSNP
rs1219907008	1032	dbSNP
rs199803302	1032	dbSNP
rs1491027689	1033	dbSNP
rs868946658	1033	dbSNP
rs1368544240	1035	dbSNP
rs1429121875	1035	dbSNP
rs868977825	1035	dbSNP
rs868966119	1037	dbSNP
rs1365127305	1041	dbSNP
rs1291065658	1043	dbSNP
rs1423131765	1043	dbSNP
rs1386114140	1044	dbSNP
rs1382204584	1046	dbSNP
rs1294021526	1047	dbSNP
rs1324193773	1047	dbSNP
rs1315314190	1048	dbSNP
rs1358211475	1050	dbSNP
rs1219778134	1052	dbSNP
rs1262335270	1058	dbSNP
rs1189937128	1062	dbSNP
rs1204509020	1062	dbSNP
rs1462716432	1062	dbSNP
rs1486051828	1062	dbSNP
rs377158860	1062	dbSNP
rs782646356	1062	dbSNP
rs879982523	1062	dbSNP
rs1453434515	1064	dbSNP
rs1287661799	1074	dbSNP
rs1408853632	1077	dbSNP
rs11093407	1082	dbSNP
rs1336881158	1095	dbSNP
rs1381393704	1096	dbSNP
rs1308638842	1097	dbSNP
rs1317334436	1104	dbSNP
rs1237978287	1105	dbSNP
rs1258907366	1107	dbSNP
rs1325658302	1108	dbSNP
rs1204217500	1118	dbSNP
rs1460020306	1121	dbSNP
rs1179193731	1127	dbSNP
rs782217982	1131	dbSNP
rs1418865625	1134	dbSNP
rs782571873	1136	dbSNP
rs1431883905	1138	dbSNP
rs782446385	1142	dbSNP
rs782099834	1145	dbSNP
rs782810230	1156	dbSNP
rs1445125494	1160	dbSNP
rs1299534132	1173	dbSNP
rs1373540123	1183	dbSNP
rs1390450194	1184	dbSNP
rs1286301343	1185	dbSNP
rs1325380576	1187	dbSNP
rs1224100215	1196	dbSNP
rs1262378903	1197	dbSNP
rs781984693	1197	dbSNP
rs782800060	1198	dbSNP
rs1252122759	1203	dbSNP
rs11093406	1206	dbSNP
rs1175694824	1214	dbSNP
rs1271544466	1215	dbSNP
rs1199374640	1217	dbSNP
rs1480952871	1217	dbSNP
rs1427736409	1221	dbSNP
rs1412277913	1232	dbSNP
rs1171978052	1236	dbSNP
rs1354609541	1249	dbSNP
rs1461208941	1251	dbSNP
rs369676234	1251	dbSNP
rs1347186618	1273	dbSNP
rs782042181	1279	dbSNP
rs1282563909	1282	dbSNP
rs1365332670	1289	dbSNP
rs782317613	1291	dbSNP
rs150942695	1293	dbSNP
rs781967874	1297	dbSNP
rs1203336014	1319	dbSNP
rs1294157494	1352	dbSNP
rs1490618190	1358	dbSNP
rs1222145761	1362	dbSNP
rs1267199853	1364	dbSNP
rs1476713582	1369	dbSNP
rs782363818	1369	dbSNP
rs1419673820	1378	dbSNP
rs1427360280	1385	dbSNP
rs1003842495	1399	dbSNP
rs1166362789	1400	dbSNP
rs782553956	1402	dbSNP
rs1366980071	1409	dbSNP
rs1425079952	1412	dbSNP
rs1302373034	1414	dbSNP
rs1432851747	1422	dbSNP
rs1270670856	1439	dbSNP
rs1361383215	1443	dbSNP
rs188152995	1445	dbSNP
rs1020592860	1450	dbSNP
rs1010699888	1451	dbSNP
rs1245516701	1453	dbSNP
rs782465625	1457	dbSNP
rs1288221100	1459	dbSNP
rs1449077544	1464	dbSNP
rs782432066	1465	dbSNP
rs782179930	1478	dbSNP
rs1242003709	1485	dbSNP
rs1485261613	1494	dbSNP
rs1186058049	1501	dbSNP

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2013

BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.