>SLC25A28|NM_031212|3'UTR
   1 AGTAGCACTGAACGAAGCCAGGGGTTCAGATGACACTGCTGCATCCTGGTCACATTCTCTGTCTCCTGGAATGCTCCCAC
  81 CTCAAGTGGAGTTAGAAGGAAGGTAGAGGGGCTCTCCCCCAGGATTTTGGTGTTTTGACTAACACCAGTTCCTGCCAACC
 161 TCTGTTGCCACCACCTTTCCTTCCAGGCCCTAAGCACGTGCAGCAAAGCACACCACAGCACCTTTGATAACCTCTCTCCA
 241 TCCTGGGCCTGATGACCTGCTCTAGACTGTTATAGAGGGATAAGCAGCTCATTCCCCTGGTTCCTAATAAAAAGCCTTTA
 321 AATTAAATGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucUGGGGAGGAGGUAGg 5' |||:|| ||||||| Target 5' taACCTCT-CTCCATCc 3'	228 - 243	158.00	-22.30
2	miRNA 3' ucuGGGGAGGAGGUAGg 5' | | |:|||::|| Target 5' ggtCACATTCTCTGTCt 3'	48 - 64	118.00	-10.90
3	miRNA 3' ucugGGGAGGAGGUAGg 5' | || || |||| Target 5' atgaCACTGCTGCATCc 3'	30 - 46	117.00	-15.70

Mutant ID	Mutant Position	Mutant Source
COSN16128922	32	COSMIC
COSN30506616	45	COSMIC
COSN22826575	55	COSMIC
COSN30479820	117	COSMIC
COSN30150137	130	COSMIC
COSN30181063	130	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1489818431	1	dbSNP
rs1293654382	5	dbSNP
rs1401738586	6	dbSNP
rs559139906	8	dbSNP
rs369248267	13	dbSNP
rs751623075	14	dbSNP
rs1225486787	16	dbSNP
rs781200629	32	dbSNP
rs764083339	34	dbSNP
rs754894817	35	dbSNP
rs1367906847	37	dbSNP
rs762842230	38	dbSNP
rs547518141	49	dbSNP
rs938763153	54	dbSNP
rs1222471114	61	dbSNP
rs1285716107	63	dbSNP
rs182150592	65	dbSNP
rs1276923853	68	dbSNP
rs981980453	74	dbSNP
rs1277592403	77	dbSNP
rs1441271969	80	dbSNP
rs1187855389	85	dbSNP
rs946950419	91	dbSNP
rs561578893	95	dbSNP
rs914158357	98	dbSNP
rs543288971	102	dbSNP
rs1421452403	108	dbSNP
rs1401038068	140	dbSNP
rs1373739597	141	dbSNP
rs944856493	143	dbSNP
rs879024542	153	dbSNP
rs575900588	154	dbSNP
rs1219691999	165	dbSNP
rs1334893071	168	dbSNP
rs1342526922	171	dbSNP
rs996622084	174	dbSNP
rs766229755	176	dbSNP
rs773146520	186	dbSNP
rs534212100	188	dbSNP
rs912084680	191	dbSNP
rs986176179	197	dbSNP
rs1343705500	198	dbSNP
rs1200586662	199	dbSNP
rs1280091523	202	dbSNP
rs1435773290	213	dbSNP
rs1477518407	214	dbSNP
rs766853706	221	dbSNP
rs1238581041	231	dbSNP
rs1441267880	239	dbSNP
rs1191704891	242	dbSNP
rs1004390045	252	dbSNP
rs887233963	256	dbSNP
rs1048661888	257	dbSNP
rs1404438252	271	dbSNP
rs148600046	273	dbSNP
rs1439773817	277	dbSNP
rs953495329	284	dbSNP
rs920560302	287	dbSNP
rs1236970045	290	dbSNP
rs1204466788	295	dbSNP
rs1331081102	311	dbSNP
rs1436535959	314	dbSNP
rs894506703	314	dbSNP
rs545033597	315	dbSNP
rs1201376004	328	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.